\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721134698:

Variant ID: vg0721134698 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21134698
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTTCAGCTCTCCCACTCCTTGTGCTGAACTCTTCGATAATCTCTTCACTGCTATTTCATCGCCATCAGGCAGAGTACCCTGTTCAGACCAAATCAATA[G/A]
TAACACTTAGTAATGAATATATTTTTAGTGATACTTTCTTCAGTTATGTTAGAGTCAGCACCTTGTACACTGCACCAAATCCACCTTCGCCAAGCTTGTT

Reverse complement sequence

AACAAGCTTGGCGAAGGTGGATTTGGTGCAGTGTACAAGGTGCTGACTCTAACATAACTGAAGAAAGTATCACTAAAAATATATTCATTACTAAGTGTTA[C/T]
TATTGATTTGGTCTGAACAGGGTACTCTGCCTGATGGCGATGAAATAGCAGTGAAGAGATTATCGAAGAGTTCAGCACAAGGAGTGGGAGAGCTGAAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 48.60% 0.00% 0.00% NA
All Indica  2759 21.80% 78.20% 0.00% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 75.80% 24.20% 0.00% 0.00% NA
Indica I  595 2.70% 97.30% 0.00% 0.00% NA
Indica II  465 21.10% 78.90% 0.00% 0.00% NA
Indica III  913 37.10% 62.90% 0.00% 0.00% NA
Indica Intermediate  786 19.00% 81.00% 0.00% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721134698 G -> A LOC_Os07g35300.1 downstream_gene_variant ; 2168.0bp to feature; MODIFIER silent_mutation Average:69.878; most accessible tissue: Zhenshan97 young leaf, score: 94.554 N N N N
vg0721134698 G -> A LOC_Os07g35310.1 intron_variant ; MODIFIER silent_mutation Average:69.878; most accessible tissue: Zhenshan97 young leaf, score: 94.554 N N N N
vg0721134698 G -> A LOC_Os07g35310.2 intron_variant ; MODIFIER silent_mutation Average:69.878; most accessible tissue: Zhenshan97 young leaf, score: 94.554 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721134698 G A -0.02 -0.04 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721134698 NA 2.13E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 2.63E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 4.87E-24 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 1.79E-06 1.17E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 1.65E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 2.21E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 1.27E-08 6.63E-09 mr1301 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 2.79E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 7.32E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 5.27E-32 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 1.23E-20 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721134698 NA 1.56E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251