\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721064561:

Variant ID: vg0721064561 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21064561
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATGTTGACCTCACCAAATGCTACAGGGCATGGAGGACGCCATCAACCAAGGTGCCACCCCTATTGTCACACCCCAATCCGGCACCGCCGTACAATGC[C/A]
GCCTGACAGGAGCGTGTCGTAGGAATAACGGCGCGAACCGCTTCCTACGAAACCGCGATCTCAGTACCAGTACCAGGACATAGTGCTGGTACCCACGGTG

Reverse complement sequence

CACCGTGGGTACCAGCACTATGTCCTGGTACTGGTACTGAGATCGCGGTTTCGTAGGAAGCGGTTCGCGCCGTTATTCCTACGACACGCTCCTGTCAGGC[G/T]
GCATTGTACGGCGGTGCCGGATTGGGGTGTGACAATAGGGGTGGCACCTTGGTTGATGGCGTCCTCCATGCCCTGTAGCATTTGGTGAGGTCAACATAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 8.60% 1.23% 49.43% NA
All Indica  2759 15.90% 3.50% 0.40% 80.17% NA
All Japonica  1512 78.80% 19.40% 0.20% 1.52% NA
Aus  269 74.00% 0.00% 15.99% 10.04% NA
Indica I  595 12.10% 0.00% 0.17% 87.73% NA
Indica II  465 15.90% 4.50% 0.22% 79.35% NA
Indica III  913 17.40% 6.60% 0.11% 75.90% NA
Indica Intermediate  786 17.00% 2.00% 1.02% 79.90% NA
Temperate Japonica  767 98.30% 0.50% 0.26% 0.91% NA
Tropical Japonica  504 46.20% 53.20% 0.20% 0.40% NA
Japonica Intermediate  241 85.10% 9.10% 0.00% 5.81% NA
VI/Aromatic  96 60.40% 3.10% 0.00% 36.46% NA
Intermediate  90 43.30% 12.20% 1.11% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721064561 C -> DEL N N silent_mutation Average:69.145; most accessible tissue: Zhenshan97 root, score: 86.579 N N N N
vg0721064561 C -> A LOC_Os07g35180.1 downstream_gene_variant ; 1593.0bp to feature; MODIFIER silent_mutation Average:69.145; most accessible tissue: Zhenshan97 root, score: 86.579 N N N N
vg0721064561 C -> A LOC_Os07g35180-LOC_Os07g35190 intergenic_region ; MODIFIER silent_mutation Average:69.145; most accessible tissue: Zhenshan97 root, score: 86.579 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0721064561 C A -0.04 -0.02 -0.02 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721064561 NA 4.81E-07 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 NA 8.59E-08 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 NA 2.43E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 NA 7.51E-07 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 NA 1.09E-07 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 7.58E-06 2.71E-07 mr1679_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 1.78E-06 5.92E-09 mr1691_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 NA 3.16E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 NA 3.06E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 NA 3.45E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721064561 NA 1.28E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251