\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721053259:

Variant ID: vg0721053259 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 21053259
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTGGCACAATTTGCTACTATGGACTAGCAAATGCTAAATGCCAAATTGCTAAGTTTTACTACTAGTGTTTAGGTCCAAAATGACAAAAAGTGCTTCAA[A/G]
ATGGCAAAACTTTTGTCATTTTGAAGGATCTAAACAGGGCCGAAGTCACAACATACCCCTGATCGTGGTCGCATGCATTAAGGCATCCATGCATGTATGT

Reverse complement sequence

ACATACATGCATGGATGCCTTAATGCATGCGACCACGATCAGGGGTATGTTGTGACTTCGGCCCTGTTTAGATCCTTCAAAATGACAAAAGTTTTGCCAT[T/C]
TTGAAGCACTTTTTGTCATTTTGGACCTAAACACTAGTAGTAAAACTTAGCAATTTGGCATTTAGCATTTGCTAGTCCATAGTAGCAAATTGTGCCAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 9.30% 0.83% 0.68% NA
All Indica  2759 96.20% 3.80% 0.00% 0.00% NA
All Japonica  1512 79.90% 15.40% 2.58% 2.12% NA
Aus  269 82.50% 17.50% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 94.00% 6.00% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 94.30% 0.80% 4.95% 0.00% NA
Tropical Japonica  504 56.00% 40.30% 0.00% 3.77% NA
Japonica Intermediate  241 84.20% 10.00% 0.41% 5.39% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0721053259 A -> DEL N N silent_mutation Average:45.349; most accessible tissue: Callus, score: 64.452 N N N N
vg0721053259 A -> G LOC_Os07g35150.1 upstream_gene_variant ; 1308.0bp to feature; MODIFIER silent_mutation Average:45.349; most accessible tissue: Callus, score: 64.452 N N N N
vg0721053259 A -> G LOC_Os07g35160.1 upstream_gene_variant ; 1194.0bp to feature; MODIFIER silent_mutation Average:45.349; most accessible tissue: Callus, score: 64.452 N N N N
vg0721053259 A -> G LOC_Os07g35140.1 downstream_gene_variant ; 2773.0bp to feature; MODIFIER silent_mutation Average:45.349; most accessible tissue: Callus, score: 64.452 N N N N
vg0721053259 A -> G LOC_Os07g35140.2 downstream_gene_variant ; 3862.0bp to feature; MODIFIER silent_mutation Average:45.349; most accessible tissue: Callus, score: 64.452 N N N N
vg0721053259 A -> G LOC_Os07g35150-LOC_Os07g35160 intergenic_region ; MODIFIER silent_mutation Average:45.349; most accessible tissue: Callus, score: 64.452 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0721053259 8.96E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 3.59E-11 NA mr1083 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 NA 6.83E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 1.48E-08 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 4.56E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 1.37E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 NA 1.58E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 3.83E-07 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 NA 6.99E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 NA 3.41E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 NA 1.72E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721053259 NA 9.31E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251