\
| Variant ID: vg0721053259 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21053259 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTTGGCACAATTTGCTACTATGGACTAGCAAATGCTAAATGCCAAATTGCTAAGTTTTACTACTAGTGTTTAGGTCCAAAATGACAAAAAGTGCTTCAA[A/G]
ATGGCAAAACTTTTGTCATTTTGAAGGATCTAAACAGGGCCGAAGTCACAACATACCCCTGATCGTGGTCGCATGCATTAAGGCATCCATGCATGTATGT
ACATACATGCATGGATGCCTTAATGCATGCGACCACGATCAGGGGTATGTTGTGACTTCGGCCCTGTTTAGATCCTTCAAAATGACAAAAGTTTTGCCAT[T/C]
TTGAAGCACTTTTTGTCATTTTGGACCTAAACACTAGTAGTAAAACTTAGCAATTTGGCATTTAGCATTTGCTAGTCCATAGTAGCAAATTGTGCCAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 9.30% | 0.83% | 0.68% | NA |
| All Indica | 2759 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.90% | 15.40% | 2.58% | 2.12% | NA |
| Aus | 269 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 0.80% | 4.95% | 0.00% | NA |
| Tropical Japonica | 504 | 56.00% | 40.30% | 0.00% | 3.77% | NA |
| Japonica Intermediate | 241 | 84.20% | 10.00% | 0.41% | 5.39% | NA |
| VI/Aromatic | 96 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721053259 | A -> DEL | N | N | silent_mutation | Average:45.349; most accessible tissue: Callus, score: 64.452 | N | N | N | N |
| vg0721053259 | A -> G | LOC_Os07g35150.1 | upstream_gene_variant ; 1308.0bp to feature; MODIFIER | silent_mutation | Average:45.349; most accessible tissue: Callus, score: 64.452 | N | N | N | N |
| vg0721053259 | A -> G | LOC_Os07g35160.1 | upstream_gene_variant ; 1194.0bp to feature; MODIFIER | silent_mutation | Average:45.349; most accessible tissue: Callus, score: 64.452 | N | N | N | N |
| vg0721053259 | A -> G | LOC_Os07g35140.1 | downstream_gene_variant ; 2773.0bp to feature; MODIFIER | silent_mutation | Average:45.349; most accessible tissue: Callus, score: 64.452 | N | N | N | N |
| vg0721053259 | A -> G | LOC_Os07g35140.2 | downstream_gene_variant ; 3862.0bp to feature; MODIFIER | silent_mutation | Average:45.349; most accessible tissue: Callus, score: 64.452 | N | N | N | N |
| vg0721053259 | A -> G | LOC_Os07g35150-LOC_Os07g35160 | intergenic_region ; MODIFIER | silent_mutation | Average:45.349; most accessible tissue: Callus, score: 64.452 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721053259 | 8.96E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | 3.59E-11 | NA | mr1083 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | NA | 6.83E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | 1.48E-08 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | 4.56E-06 | NA | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | 1.37E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | NA | 1.58E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | 3.83E-07 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | NA | 6.99E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | NA | 3.41E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | NA | 1.72E-06 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721053259 | NA | 9.31E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |