\
| Variant ID: vg0721013564 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 21013564 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACAAATTGCATGATCCGTCTGTAAACTGGAGACGAATTTATTAAGCCTAATTAATCTGTAATTAGCAAATATTTAATGTAGCATCACATTGACAAATCAT[A/G]
GAGCATTTAGGCTTAAAATATTCATCTCGCAATTTACACGTAATCTGTGTAATTAGTTTTTTTTCTATATTTAATACTTTATGTATGTGTCCAAATATTC
GAATATTTGGACACATACATAAAGTATTAAATATAGAAAAAAAACTAATTACACAGATTACGTGTAAATTGCGAGATGAATATTTTAAGCCTAAATGCTC[T/C]
ATGATTTGTCAATGTGATGCTACATTAAATATTTGCTAATTACAGATTAATTAGGCTTAATAAATTCGTCTCCAGTTTACAGACGGATCATGCAATTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.10% | 31.00% | 3.32% | 11.64% | NA |
| All Indica | 2759 | 78.60% | 8.50% | 1.85% | 11.02% | NA |
| All Japonica | 1512 | 16.30% | 75.90% | 3.97% | 3.90% | NA |
| Aus | 269 | 19.30% | 0.40% | 14.50% | 65.80% | NA |
| Indica I | 595 | 87.90% | 2.70% | 0.17% | 9.24% | NA |
| Indica II | 465 | 82.60% | 15.30% | 0.00% | 2.15% | NA |
| Indica III | 913 | 71.20% | 9.20% | 4.49% | 15.12% | NA |
| Indica Intermediate | 786 | 77.90% | 8.10% | 1.15% | 12.85% | NA |
| Temperate Japonica | 767 | 1.20% | 98.30% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 40.30% | 41.10% | 10.91% | 7.74% | NA |
| Japonica Intermediate | 241 | 14.10% | 77.20% | 0.83% | 7.88% | NA |
| VI/Aromatic | 96 | 41.70% | 50.00% | 4.17% | 4.17% | NA |
| Intermediate | 90 | 53.30% | 36.70% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0721013564 | A -> DEL | N | N | silent_mutation | Average:33.577; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0721013564 | A -> G | LOC_Os07g35070.1 | downstream_gene_variant ; 3708.0bp to feature; MODIFIER | silent_mutation | Average:33.577; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0721013564 | A -> G | LOC_Os07g35080.1 | downstream_gene_variant ; 2222.0bp to feature; MODIFIER | silent_mutation | Average:33.577; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0721013564 | A -> G | LOC_Os07g35070-LOC_Os07g35080 | intergenic_region ; MODIFIER | silent_mutation | Average:33.577; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0721013564 | NA | 5.56E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721013564 | NA | 6.08E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721013564 | NA | 8.74E-06 | mr1898 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721013564 | NA | 2.49E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721013564 | NA | 3.11E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721013564 | 9.57E-07 | NA | mr1134_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721013564 | NA | 3.22E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0721013564 | NA | 4.84E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |