\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720924027:

Variant ID: vg0720924027 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20924027
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.12, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


AATAAAGGAGCAACCGGATTTAGGCTGACTCTATCTTTACTAAAGAGGCTATATATTTAAAAATAGATTTTTACTCCCGGTTATTTCACCCGGGACTAAA[A/G,C]
ATAACGATCTTTAGTCCCGGATTCGTAGTACCGGTTGGAAAACCAGGACTATATAGGTTACGAACCGGGAATAAAAACCATTTCTCCACTAGTGTATGTT

Reverse complement sequence

AACATACACTAGTGGAGAAATGGTTTTTATTCCCGGTTCGTAACCTATATAGTCCTGGTTTTCCAACCGGTACTACGAATCCGGGACTAAAGATCGTTAT[T/C,G]
TTTAGTCCCGGGTGAAATAACCGGGAGTAAAAATCTATTTTTAAATATATAGCCTCTTTAGTAAAGATAGAGTCAGCCTAAATCCGGTTGCTCCTTTATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 35.50% 0.38% 15.91% C: 0.02%
All Indica  2759 70.80% 10.30% 0.33% 18.56% NA
All Japonica  1512 1.60% 89.20% 0.13% 9.06% C: 0.07%
Aus  269 79.90% 0.00% 0.37% 19.70% NA
Indica I  595 88.20% 8.20% 0.00% 3.53% NA
Indica II  465 76.30% 9.90% 0.65% 13.12% NA
Indica III  913 56.00% 8.10% 0.33% 35.60% NA
Indica Intermediate  786 71.60% 14.60% 0.38% 13.36% NA
Temperate Japonica  767 0.80% 82.30% 0.26% 16.69% NA
Tropical Japonica  504 1.00% 98.60% 0.00% 0.40% NA
Japonica Intermediate  241 5.40% 91.30% 0.00% 2.90% C: 0.41%
VI/Aromatic  96 40.60% 6.20% 5.21% 47.92% NA
Intermediate  90 48.90% 45.60% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720924027 A -> DEL N N silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0720924027 A -> G LOC_Os07g34900.1 upstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0720924027 A -> G LOC_Os07g34910.1 upstream_gene_variant ; 1876.0bp to feature; MODIFIER silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0720924027 A -> G LOC_Os07g34920.1 downstream_gene_variant ; 2825.0bp to feature; MODIFIER silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0720924027 A -> G LOC_Os07g34900-LOC_Os07g34910 intergenic_region ; MODIFIER silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0720924027 A -> C LOC_Os07g34900.1 upstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0720924027 A -> C LOC_Os07g34910.1 upstream_gene_variant ; 1876.0bp to feature; MODIFIER silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0720924027 A -> C LOC_Os07g34920.1 downstream_gene_variant ; 2825.0bp to feature; MODIFIER silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0720924027 A -> C LOC_Os07g34900-LOC_Os07g34910 intergenic_region ; MODIFIER silent_mutation Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720924027 NA 9.46E-12 mr1595 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251