\
| Variant ID: vg0720924027 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20924027 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.12, others allele: 0.00, population size: 68. )
AATAAAGGAGCAACCGGATTTAGGCTGACTCTATCTTTACTAAAGAGGCTATATATTTAAAAATAGATTTTTACTCCCGGTTATTTCACCCGGGACTAAA[A/G,C]
ATAACGATCTTTAGTCCCGGATTCGTAGTACCGGTTGGAAAACCAGGACTATATAGGTTACGAACCGGGAATAAAAACCATTTCTCCACTAGTGTATGTT
AACATACACTAGTGGAGAAATGGTTTTTATTCCCGGTTCGTAACCTATATAGTCCTGGTTTTCCAACCGGTACTACGAATCCGGGACTAAAGATCGTTAT[T/C,G]
TTTAGTCCCGGGTGAAATAACCGGGAGTAAAAATCTATTTTTAAATATATAGCCTCTTTAGTAAAGATAGAGTCAGCCTAAATCCGGTTGCTCCTTTATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.20% | 35.50% | 0.38% | 15.91% | C: 0.02% |
| All Indica | 2759 | 70.80% | 10.30% | 0.33% | 18.56% | NA |
| All Japonica | 1512 | 1.60% | 89.20% | 0.13% | 9.06% | C: 0.07% |
| Aus | 269 | 79.90% | 0.00% | 0.37% | 19.70% | NA |
| Indica I | 595 | 88.20% | 8.20% | 0.00% | 3.53% | NA |
| Indica II | 465 | 76.30% | 9.90% | 0.65% | 13.12% | NA |
| Indica III | 913 | 56.00% | 8.10% | 0.33% | 35.60% | NA |
| Indica Intermediate | 786 | 71.60% | 14.60% | 0.38% | 13.36% | NA |
| Temperate Japonica | 767 | 0.80% | 82.30% | 0.26% | 16.69% | NA |
| Tropical Japonica | 504 | 1.00% | 98.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 5.40% | 91.30% | 0.00% | 2.90% | C: 0.41% |
| VI/Aromatic | 96 | 40.60% | 6.20% | 5.21% | 47.92% | NA |
| Intermediate | 90 | 48.90% | 45.60% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720924027 | A -> DEL | N | N | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0720924027 | A -> G | LOC_Os07g34900.1 | upstream_gene_variant ; 3295.0bp to feature; MODIFIER | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0720924027 | A -> G | LOC_Os07g34910.1 | upstream_gene_variant ; 1876.0bp to feature; MODIFIER | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0720924027 | A -> G | LOC_Os07g34920.1 | downstream_gene_variant ; 2825.0bp to feature; MODIFIER | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0720924027 | A -> G | LOC_Os07g34900-LOC_Os07g34910 | intergenic_region ; MODIFIER | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0720924027 | A -> C | LOC_Os07g34900.1 | upstream_gene_variant ; 3295.0bp to feature; MODIFIER | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0720924027 | A -> C | LOC_Os07g34910.1 | upstream_gene_variant ; 1876.0bp to feature; MODIFIER | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0720924027 | A -> C | LOC_Os07g34920.1 | downstream_gene_variant ; 2825.0bp to feature; MODIFIER | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0720924027 | A -> C | LOC_Os07g34900-LOC_Os07g34910 | intergenic_region ; MODIFIER | silent_mutation | Average:48.289; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720924027 | NA | 9.46E-12 | mr1595 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |