\
| Variant ID: vg0720910687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20910687 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATGTGAAACAAGATTAAAACATATTGCATTGTAATATGGAGAACCAGTTGCTCTTGATACAAATCGAACAGGAGAACATTAACAATATTAAAAAACTATA[A/G,C]
AAACAAAAATTTGATAGATGAAGGTCAGAAATGGTATGAATGACTACATACCTACCAGTCTTATAAATCCAACCTGAATACAAAATGGCTGTATTTTACA
TGTAAAATACAGCCATTTTGTATTCAGGTTGGATTTATAAGACTGGTAGGTATGTAGTCATTCATACCATTTCTGACCTTCATCTATCAAATTTTTGTTT[T/C,G]
TATAGTTTTTTAATATTGTTAATGTTCTCCTGTTCGATTTGTATCAAGAGCAACTGGTTCTCCATATTACAATGCAATATGTTTTAATCTTGTTTCACAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.80% | 14.90% | 7.64% | 31.78% | C: 0.87% |
| All Indica | 2759 | 26.70% | 8.60% | 10.44% | 52.85% | C: 1.45% |
| All Japonica | 1512 | 84.40% | 15.10% | 0.26% | 0.20% | NA |
| Aus | 269 | 2.60% | 76.20% | 13.75% | 7.43% | NA |
| Indica I | 595 | 20.50% | 1.00% | 4.03% | 74.45% | NA |
| Indica II | 465 | 19.80% | 4.10% | 10.11% | 65.38% | C: 0.65% |
| Indica III | 913 | 28.30% | 16.80% | 18.07% | 33.52% | C: 3.40% |
| Indica Intermediate | 786 | 33.70% | 7.40% | 6.62% | 51.53% | C: 0.76% |
| Temperate Japonica | 767 | 82.70% | 16.70% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 83.10% | 16.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 24.00% | 30.21% | 0.00% | C: 1.04% |
| Intermediate | 90 | 61.10% | 12.20% | 3.33% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720910687 | A -> DEL | N | N | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| vg0720910687 | A -> G | LOC_Os07g34890.1 | upstream_gene_variant ; 1521.0bp to feature; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| vg0720910687 | A -> G | LOC_Os07g34880.1 | downstream_gene_variant ; 4855.0bp to feature; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| vg0720910687 | A -> G | LOC_Os07g34880-LOC_Os07g34890 | intergenic_region ; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| vg0720910687 | A -> C | LOC_Os07g34890.1 | upstream_gene_variant ; 1521.0bp to feature; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| vg0720910687 | A -> C | LOC_Os07g34880.1 | downstream_gene_variant ; 4855.0bp to feature; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| vg0720910687 | A -> C | LOC_Os07g34880-LOC_Os07g34890 | intergenic_region ; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720910687 | NA | 3.30E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720910687 | 1.62E-06 | NA | mr1807_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |