\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720879562:

Variant ID: vg0720879562 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20879562
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCTTATCAGCGACTCCCCGTCGCCAACGCGTCCCTCCCTCAGTTGCCTTCACCAGCCCAGCGACAACTCCACGGTGGTAGCTTGGTAGGTATGCTCTCT[C/T]
ATCCCCTAATCTGTAAGGCTTAAGGAACTACAAAGGTGCTTTGATTTGTTTGTGTGATTCAATTTGTCCAGACTTTATGTTGAGTTCTACCCCATCGGAT

Reverse complement sequence

ATCCGATGGGGTAGAACTCAACATAAAGTCTGGACAAATTGAATCACACAAACAAATCAAAGCACCTTTGTAGTTCCTTAAGCCTTACAGATTAGGGGAT[G/A]
AGAGAGCATACCTACCAAGCTACCACCGTGGAGTTGTCGCTGGGCTGGTGAAGGCAACTGAGGGAGGGACGCGTTGGCGACGGGGAGTCGCTGATAAGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 35.00% 8.72% 12.38% NA
All Indica  2759 55.10% 22.10% 12.03% 10.80% NA
All Japonica  1512 27.70% 51.70% 2.31% 18.32% NA
Aus  269 11.50% 75.10% 12.27% 1.12% NA
Indica I  595 49.40% 17.50% 13.95% 19.16% NA
Indica II  465 66.90% 11.20% 11.18% 10.75% NA
Indica III  913 54.00% 24.80% 14.46% 6.79% NA
Indica Intermediate  786 53.60% 29.00% 8.27% 9.16% NA
Temperate Japonica  767 20.70% 49.40% 2.74% 27.12% NA
Tropical Japonica  504 43.80% 47.20% 1.79% 7.14% NA
Japonica Intermediate  241 16.20% 68.00% 2.07% 13.69% NA
VI/Aromatic  96 77.10% 16.70% 6.25% 0.00% NA
Intermediate  90 37.80% 47.80% 6.67% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720879562 C -> DEL N N silent_mutation Average:31.588; most accessible tissue: Callus, score: 52.19 N N N N
vg0720879562 C -> T LOC_Os07g34840.1 upstream_gene_variant ; 1637.0bp to feature; MODIFIER silent_mutation Average:31.588; most accessible tissue: Callus, score: 52.19 N N N N
vg0720879562 C -> T LOC_Os07g34830.1 downstream_gene_variant ; 2839.0bp to feature; MODIFIER silent_mutation Average:31.588; most accessible tissue: Callus, score: 52.19 N N N N
vg0720879562 C -> T LOC_Os07g34830-LOC_Os07g34840 intergenic_region ; MODIFIER silent_mutation Average:31.588; most accessible tissue: Callus, score: 52.19 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720879562 NA 1.01E-08 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 3.26E-06 3.26E-06 mr1595 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 NA 6.32E-11 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 NA 1.19E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 NA 1.98E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 NA 1.65E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 NA 6.55E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 NA 7.30E-14 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 NA 1.85E-10 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562 NA 2.60E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251