Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720879562:

Variant ID: vg0720879562 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20879562
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCTTATCAGCGACTCCCCGTCGCCAACGCGTCCCTCCCTCAGTTGCCTTCACCAGCCCAGCGACAACTCCACGGTGGTAGCTTGGTAGGTATGCTCTCT[C/T]
ATCCCCTAATCTGTAAGGCTTAAGGAACTACAAAGGTGCTTTGATTTGTTTGTGTGATTCAATTTGTCCAGACTTTATGTTGAGTTCTACCCCATCGGAT

Reverse complement sequence

ATCCGATGGGGTAGAACTCAACATAAAGTCTGGACAAATTGAATCACACAAACAAATCAAAGCACCTTTGTAGTTCCTTAAGCCTTACAGATTAGGGGAT[G/A]
AGAGAGCATACCTACCAAGCTACCACCGTGGAGTTGTCGCTGGGCTGGTGAAGGCAACTGAGGGAGGGACGCGTTGGCGACGGGGAGTCGCTGATAAGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	35.00%	8.72%	12.38%	NA
All Indica	2759	55.10%	22.10%	12.03%	10.80%	NA
All Japonica	1512	27.70%	51.70%	2.31%	18.32%	NA
Aus	269	11.50%	75.10%	12.27%	1.12%	NA
Indica I	595	49.40%	17.50%	13.95%	19.16%	NA
Indica II	465	66.90%	11.20%	11.18%	10.75%	NA
Indica III	913	54.00%	24.80%	14.46%	6.79%	NA
Indica Intermediate	786	53.60%	29.00%	8.27%	9.16%	NA
Temperate Japonica	767	20.70%	49.40%	2.74%	27.12%	NA
Tropical Japonica	504	43.80%	47.20%	1.79%	7.14%	NA
Japonica Intermediate	241	16.20%	68.00%	2.07%	13.69%	NA
VI/Aromatic	96	77.10%	16.70%	6.25%	0.00%	NA
Intermediate	90	37.80%	47.80%	6.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720879562	C -> DEL	N	N	silent_mutation	Average:31.588; most accessible tissue: Callus, score: 52.19	N	N	N	N
vg0720879562	C -> T	LOC_Os07g34840.1	upstream_gene_variant ; 1637.0bp to feature; MODIFIER	silent_mutation	Average:31.588; most accessible tissue: Callus, score: 52.19	N	N	N	N
vg0720879562	C -> T	LOC_Os07g34830.1	downstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:31.588; most accessible tissue: Callus, score: 52.19	N	N	N	N
vg0720879562	C -> T	LOC_Os07g34830-LOC_Os07g34840	intergenic_region ; MODIFIER	silent_mutation	Average:31.588; most accessible tissue: Callus, score: 52.19	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720879562	NA	1.01E-08	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	3.26E-06	3.26E-06	mr1595	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	NA	6.32E-11	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	NA	1.19E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	NA	1.98E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	NA	1.65E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	NA	6.55E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	NA	7.30E-14	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	NA	1.85E-10	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720879562	NA	2.60E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251