\
| Variant ID: vg0720879562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20879562 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCTTATCAGCGACTCCCCGTCGCCAACGCGTCCCTCCCTCAGTTGCCTTCACCAGCCCAGCGACAACTCCACGGTGGTAGCTTGGTAGGTATGCTCTCT[C/T]
ATCCCCTAATCTGTAAGGCTTAAGGAACTACAAAGGTGCTTTGATTTGTTTGTGTGATTCAATTTGTCCAGACTTTATGTTGAGTTCTACCCCATCGGAT
ATCCGATGGGGTAGAACTCAACATAAAGTCTGGACAAATTGAATCACACAAACAAATCAAAGCACCTTTGTAGTTCCTTAAGCCTTACAGATTAGGGGAT[G/A]
AGAGAGCATACCTACCAAGCTACCACCGTGGAGTTGTCGCTGGGCTGGTGAAGGCAACTGAGGGAGGGACGCGTTGGCGACGGGGAGTCGCTGATAAGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.90% | 35.00% | 8.72% | 12.38% | NA |
| All Indica | 2759 | 55.10% | 22.10% | 12.03% | 10.80% | NA |
| All Japonica | 1512 | 27.70% | 51.70% | 2.31% | 18.32% | NA |
| Aus | 269 | 11.50% | 75.10% | 12.27% | 1.12% | NA |
| Indica I | 595 | 49.40% | 17.50% | 13.95% | 19.16% | NA |
| Indica II | 465 | 66.90% | 11.20% | 11.18% | 10.75% | NA |
| Indica III | 913 | 54.00% | 24.80% | 14.46% | 6.79% | NA |
| Indica Intermediate | 786 | 53.60% | 29.00% | 8.27% | 9.16% | NA |
| Temperate Japonica | 767 | 20.70% | 49.40% | 2.74% | 27.12% | NA |
| Tropical Japonica | 504 | 43.80% | 47.20% | 1.79% | 7.14% | NA |
| Japonica Intermediate | 241 | 16.20% | 68.00% | 2.07% | 13.69% | NA |
| VI/Aromatic | 96 | 77.10% | 16.70% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 47.80% | 6.67% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720879562 | C -> DEL | N | N | silent_mutation | Average:31.588; most accessible tissue: Callus, score: 52.19 | N | N | N | N |
| vg0720879562 | C -> T | LOC_Os07g34840.1 | upstream_gene_variant ; 1637.0bp to feature; MODIFIER | silent_mutation | Average:31.588; most accessible tissue: Callus, score: 52.19 | N | N | N | N |
| vg0720879562 | C -> T | LOC_Os07g34830.1 | downstream_gene_variant ; 2839.0bp to feature; MODIFIER | silent_mutation | Average:31.588; most accessible tissue: Callus, score: 52.19 | N | N | N | N |
| vg0720879562 | C -> T | LOC_Os07g34830-LOC_Os07g34840 | intergenic_region ; MODIFIER | silent_mutation | Average:31.588; most accessible tissue: Callus, score: 52.19 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720879562 | NA | 1.01E-08 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | 3.26E-06 | 3.26E-06 | mr1595 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | NA | 6.32E-11 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | NA | 1.19E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | NA | 1.98E-06 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | NA | 1.65E-07 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | NA | 6.55E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | NA | 7.30E-14 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | NA | 1.85E-10 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720879562 | NA | 2.60E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |