\
| Variant ID: vg0720878455 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20878455 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 46. )
CGCGGAGGTCGTATAACTGGCGGTTCAGCTTCTTCCAGCGCTTCCGCTCGGCCTCCACGTGGCTGGCTCTGGGCTTGTTGGGACACGGTCCGAGCTTTCT[C/T]
CCCTGCCGCGGCGTCGGAGCTCCTCGACAGCTCCGAGTCTTACAAGAGCAAGCCGCTTGTCAAACTGCATGTAGCCTAAAGGTTAAGGGCTAAGTTAATT
AATTAACTTAGCCCTTAACCTTTAGGCTACATGCAGTTTGACAAGCGGCTTGCTCTTGTAAGACTCGGAGCTGTCGAGGAGCTCCGACGCCGCGGCAGGG[G/A]
AGAAAGCTCGGACCGTGTCCCAACAAGCCCAGAGCCAGCCACGTGGAGGCCGAGCGGAAGCGCTGGAAGAAGCTGAACCGCCAGTTATACGACCTCCGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.90% | 15.80% | 9.73% | 34.53% | NA |
| All Indica | 2759 | 22.00% | 18.60% | 12.50% | 46.94% | NA |
| All Japonica | 1512 | 63.20% | 13.60% | 6.61% | 16.60% | NA |
| Aus | 269 | 72.10% | 3.00% | 1.86% | 23.05% | NA |
| Indica I | 595 | 12.40% | 13.80% | 26.89% | 46.89% | NA |
| Indica II | 465 | 24.10% | 15.10% | 12.90% | 47.96% | NA |
| Indica III | 913 | 21.20% | 26.20% | 2.08% | 50.49% | NA |
| Indica Intermediate | 786 | 28.80% | 15.50% | 13.49% | 42.24% | NA |
| Temperate Japonica | 767 | 49.50% | 18.00% | 12.13% | 20.34% | NA |
| Tropical Japonica | 504 | 79.80% | 5.20% | 0.60% | 14.48% | NA |
| Japonica Intermediate | 241 | 72.20% | 17.00% | 1.66% | 9.13% | NA |
| VI/Aromatic | 96 | 81.20% | 14.60% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 60.00% | 6.70% | 10.00% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720878455 | C -> DEL | N | N | silent_mutation | Average:68.269; most accessible tissue: Callus, score: 96.841 | N | N | N | N |
| vg0720878455 | C -> T | LOC_Os07g34840.1 | upstream_gene_variant ; 2744.0bp to feature; MODIFIER | silent_mutation | Average:68.269; most accessible tissue: Callus, score: 96.841 | N | N | N | N |
| vg0720878455 | C -> T | LOC_Os07g34830.1 | downstream_gene_variant ; 1732.0bp to feature; MODIFIER | silent_mutation | Average:68.269; most accessible tissue: Callus, score: 96.841 | N | N | N | N |
| vg0720878455 | C -> T | LOC_Os07g34830-LOC_Os07g34840 | intergenic_region ; MODIFIER | silent_mutation | Average:68.269; most accessible tissue: Callus, score: 96.841 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720878455 | NA | 1.11E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | 4.46E-06 | NA | mr1089_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 7.51E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 8.97E-09 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 1.96E-10 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 4.15E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 4.91E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 7.44E-07 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 3.40E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 1.20E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720878455 | NA | 5.25E-06 | mr1954_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |