Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0720878455:

Variant ID: vg0720878455 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20878455
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGGAGGTCGTATAACTGGCGGTTCAGCTTCTTCCAGCGCTTCCGCTCGGCCTCCACGTGGCTGGCTCTGGGCTTGTTGGGACACGGTCCGAGCTTTCT[C/T]
CCCTGCCGCGGCGTCGGAGCTCCTCGACAGCTCCGAGTCTTACAAGAGCAAGCCGCTTGTCAAACTGCATGTAGCCTAAAGGTTAAGGGCTAAGTTAATT

Reverse complement sequence

AATTAACTTAGCCCTTAACCTTTAGGCTACATGCAGTTTGACAAGCGGCTTGCTCTTGTAAGACTCGGAGCTGTCGAGGAGCTCCGACGCCGCGGCAGGG[G/A]
AGAAAGCTCGGACCGTGTCCCAACAAGCCCAGAGCCAGCCACGTGGAGGCCGAGCGGAAGCGCTGGAAGAAGCTGAACCGCCAGTTATACGACCTCCGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.90%	15.80%	9.73%	34.53%	NA
All Indica	2759	22.00%	18.60%	12.50%	46.94%	NA
All Japonica	1512	63.20%	13.60%	6.61%	16.60%	NA
Aus	269	72.10%	3.00%	1.86%	23.05%	NA
Indica I	595	12.40%	13.80%	26.89%	46.89%	NA
Indica II	465	24.10%	15.10%	12.90%	47.96%	NA
Indica III	913	21.20%	26.20%	2.08%	50.49%	NA
Indica Intermediate	786	28.80%	15.50%	13.49%	42.24%	NA
Temperate Japonica	767	49.50%	18.00%	12.13%	20.34%	NA
Tropical Japonica	504	79.80%	5.20%	0.60%	14.48%	NA
Japonica Intermediate	241	72.20%	17.00%	1.66%	9.13%	NA
VI/Aromatic	96	81.20%	14.60%	1.04%	3.12%	NA
Intermediate	90	60.00%	6.70%	10.00%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720878455	C -> DEL	N	N	silent_mutation	Average:68.269; most accessible tissue: Callus, score: 96.841	N	N	N	N
vg0720878455	C -> T	LOC_Os07g34840.1	upstream_gene_variant ; 2744.0bp to feature; MODIFIER	silent_mutation	Average:68.269; most accessible tissue: Callus, score: 96.841	N	N	N	N
vg0720878455	C -> T	LOC_Os07g34830.1	downstream_gene_variant ; 1732.0bp to feature; MODIFIER	silent_mutation	Average:68.269; most accessible tissue: Callus, score: 96.841	N	N	N	N
vg0720878455	C -> T	LOC_Os07g34830-LOC_Os07g34840	intergenic_region ; MODIFIER	silent_mutation	Average:68.269; most accessible tissue: Callus, score: 96.841	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720878455	NA	1.11E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	4.46E-06	NA	mr1089_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	7.51E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	8.97E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	1.96E-10	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	4.15E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	4.91E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	7.44E-07	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	3.40E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	1.20E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455	NA	5.25E-06	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251