\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720878455:

Variant ID: vg0720878455 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20878455
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGGAGGTCGTATAACTGGCGGTTCAGCTTCTTCCAGCGCTTCCGCTCGGCCTCCACGTGGCTGGCTCTGGGCTTGTTGGGACACGGTCCGAGCTTTCT[C/T]
CCCTGCCGCGGCGTCGGAGCTCCTCGACAGCTCCGAGTCTTACAAGAGCAAGCCGCTTGTCAAACTGCATGTAGCCTAAAGGTTAAGGGCTAAGTTAATT

Reverse complement sequence

AATTAACTTAGCCCTTAACCTTTAGGCTACATGCAGTTTGACAAGCGGCTTGCTCTTGTAAGACTCGGAGCTGTCGAGGAGCTCCGACGCCGCGGCAGGG[G/A]
AGAAAGCTCGGACCGTGTCCCAACAAGCCCAGAGCCAGCCACGTGGAGGCCGAGCGGAAGCGCTGGAAGAAGCTGAACCGCCAGTTATACGACCTCCGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 15.80% 9.73% 34.53% NA
All Indica  2759 22.00% 18.60% 12.50% 46.94% NA
All Japonica  1512 63.20% 13.60% 6.61% 16.60% NA
Aus  269 72.10% 3.00% 1.86% 23.05% NA
Indica I  595 12.40% 13.80% 26.89% 46.89% NA
Indica II  465 24.10% 15.10% 12.90% 47.96% NA
Indica III  913 21.20% 26.20% 2.08% 50.49% NA
Indica Intermediate  786 28.80% 15.50% 13.49% 42.24% NA
Temperate Japonica  767 49.50% 18.00% 12.13% 20.34% NA
Tropical Japonica  504 79.80% 5.20% 0.60% 14.48% NA
Japonica Intermediate  241 72.20% 17.00% 1.66% 9.13% NA
VI/Aromatic  96 81.20% 14.60% 1.04% 3.12% NA
Intermediate  90 60.00% 6.70% 10.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720878455 C -> DEL N N silent_mutation Average:68.269; most accessible tissue: Callus, score: 96.841 N N N N
vg0720878455 C -> T LOC_Os07g34840.1 upstream_gene_variant ; 2744.0bp to feature; MODIFIER silent_mutation Average:68.269; most accessible tissue: Callus, score: 96.841 N N N N
vg0720878455 C -> T LOC_Os07g34830.1 downstream_gene_variant ; 1732.0bp to feature; MODIFIER silent_mutation Average:68.269; most accessible tissue: Callus, score: 96.841 N N N N
vg0720878455 C -> T LOC_Os07g34830-LOC_Os07g34840 intergenic_region ; MODIFIER silent_mutation Average:68.269; most accessible tissue: Callus, score: 96.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720878455 NA 1.11E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 4.46E-06 NA mr1089_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 7.51E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 8.97E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 1.96E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 4.15E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 4.91E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 7.44E-07 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 3.40E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 1.20E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720878455 NA 5.25E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251