\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720805926:

Variant ID: vg0720805926 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20805926
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATATTACCTCAGTCGTAAAATATAGCTATTTTTAGTACAATACTTTATCTAAACTGAAACTATTTCTTCACTTATCTTCTTCTCTTAACCAATTACAA[C/T]
CATTCTTTTTTATCTACTTTCTCTTCTCAACCAATCACATACTTCCTCTAATCATTTTTATATTTTTTTAACCCATATTAACCTAAAAAAATACTTACAT

Reverse complement sequence

ATGTAAGTATTTTTTTAGGTTAATATGGGTTAAAAAAATATAAAAATGATTAGAGGAAGTATGTGATTGGTTGAGAAGAGAAAGTAGATAAAAAAGAATG[G/A]
TTGTAATTGGTTAAGAGAAGAAGATAAGTGAAGAAATAGTTTCAGTTTAGATAAAGTATTGTACTAAAAATAGCTATATTTTACGACTGAGGTAATATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 1.30% 1.31% 0.40% NA
All Indica  2759 99.60% 0.00% 0.40% 0.00% NA
All Japonica  1512 91.80% 3.70% 3.24% 1.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 0.10% 1.02% 0.00% NA
Temperate Japonica  767 94.70% 1.70% 3.65% 0.00% NA
Tropical Japonica  504 93.80% 1.00% 1.39% 3.77% NA
Japonica Intermediate  241 78.40% 15.80% 5.81% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720805926 C -> DEL N N silent_mutation Average:71.596; most accessible tissue: Callus, score: 98.43 N N N N
vg0720805926 C -> T LOC_Os07g34720.1 upstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:71.596; most accessible tissue: Callus, score: 98.43 N N N N
vg0720805926 C -> T LOC_Os07g34710.1 downstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:71.596; most accessible tissue: Callus, score: 98.43 N N N N
vg0720805926 C -> T LOC_Os07g34730.1 downstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:71.596; most accessible tissue: Callus, score: 98.43 N N N N
vg0720805926 C -> T LOC_Os07g34710.3 downstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:71.596; most accessible tissue: Callus, score: 98.43 N N N N
vg0720805926 C -> T LOC_Os07g34710.2 downstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:71.596; most accessible tissue: Callus, score: 98.43 N N N N
vg0720805926 C -> T LOC_Os07g34710-LOC_Os07g34720 intergenic_region ; MODIFIER silent_mutation Average:71.596; most accessible tissue: Callus, score: 98.43 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720805926 1.05E-11 1.64E-11 mr1679 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926 1.31E-09 1.77E-11 mr1691 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926 3.53E-12 5.90E-16 mr1693 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926 4.58E-09 3.71E-09 mr1720 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926 NA 5.46E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926 NA 1.60E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926 1.48E-08 8.02E-08 mr1679_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926 1.31E-08 2.10E-11 mr1691_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926 1.13E-08 2.78E-10 mr1720_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251