\
| Variant ID: vg0720805926 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20805926 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTATATTACCTCAGTCGTAAAATATAGCTATTTTTAGTACAATACTTTATCTAAACTGAAACTATTTCTTCACTTATCTTCTTCTCTTAACCAATTACAA[C/T]
CATTCTTTTTTATCTACTTTCTCTTCTCAACCAATCACATACTTCCTCTAATCATTTTTATATTTTTTTAACCCATATTAACCTAAAAAAATACTTACAT
ATGTAAGTATTTTTTTAGGTTAATATGGGTTAAAAAAATATAAAAATGATTAGAGGAAGTATGTGATTGGTTGAGAAGAGAAAGTAGATAAAAAAGAATG[G/A]
TTGTAATTGGTTAAGAGAAGAAGATAAGTGAAGAAATAGTTTCAGTTTAGATAAAGTATTGTACTAAAAATAGCTATATTTTACGACTGAGGTAATATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.00% | 1.30% | 1.31% | 0.40% | NA |
| All Indica | 2759 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 91.80% | 3.70% | 3.24% | 1.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.10% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 94.70% | 1.70% | 3.65% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 1.00% | 1.39% | 3.77% | NA |
| Japonica Intermediate | 241 | 78.40% | 15.80% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720805926 | C -> DEL | N | N | silent_mutation | Average:71.596; most accessible tissue: Callus, score: 98.43 | N | N | N | N |
| vg0720805926 | C -> T | LOC_Os07g34720.1 | upstream_gene_variant ; 728.0bp to feature; MODIFIER | silent_mutation | Average:71.596; most accessible tissue: Callus, score: 98.43 | N | N | N | N |
| vg0720805926 | C -> T | LOC_Os07g34710.1 | downstream_gene_variant ; 450.0bp to feature; MODIFIER | silent_mutation | Average:71.596; most accessible tissue: Callus, score: 98.43 | N | N | N | N |
| vg0720805926 | C -> T | LOC_Os07g34730.1 | downstream_gene_variant ; 2107.0bp to feature; MODIFIER | silent_mutation | Average:71.596; most accessible tissue: Callus, score: 98.43 | N | N | N | N |
| vg0720805926 | C -> T | LOC_Os07g34710.3 | downstream_gene_variant ; 450.0bp to feature; MODIFIER | silent_mutation | Average:71.596; most accessible tissue: Callus, score: 98.43 | N | N | N | N |
| vg0720805926 | C -> T | LOC_Os07g34710.2 | downstream_gene_variant ; 450.0bp to feature; MODIFIER | silent_mutation | Average:71.596; most accessible tissue: Callus, score: 98.43 | N | N | N | N |
| vg0720805926 | C -> T | LOC_Os07g34710-LOC_Os07g34720 | intergenic_region ; MODIFIER | silent_mutation | Average:71.596; most accessible tissue: Callus, score: 98.43 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720805926 | 1.05E-11 | 1.64E-11 | mr1679 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720805926 | 1.31E-09 | 1.77E-11 | mr1691 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720805926 | 3.53E-12 | 5.90E-16 | mr1693 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720805926 | 4.58E-09 | 3.71E-09 | mr1720 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720805926 | NA | 5.46E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720805926 | NA | 1.60E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720805926 | 1.48E-08 | 8.02E-08 | mr1679_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720805926 | 1.31E-08 | 2.10E-11 | mr1691_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720805926 | 1.13E-08 | 2.78E-10 | mr1720_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |