\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720679202:

Variant ID: vg0720679202 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20679202
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTTCGAAATTTCGTCCCCTCCACTAAGCAAATATCTCACCTGAACTTTTTGAGTTTTCTATTTGTTGGATTTGACCAAACCTAGTCTACGAAGATGTT[T/C]
ATAGGGATAAGATTTGAGTGAGTGCGTTCATAGGGGTGAGTGCGTGCGTTGTGAGTGACTGCGTTGCACTGTGTAATTTAAAAAAATATATTAAAATTCA

Reverse complement sequence

TGAATTTTAATATATTTTTTTAAATTACACAGTGCAACGCAGTCACTCACAACGCACGCACTCACCCCTATGAACGCACTCACTCAAATCTTATCCCTAT[A/G]
AACATCTTCGTAGACTAGGTTTGGTCAAATCCAACAAATAGAAAACTCAAAAAGTTCAGGTGAGATATTTGCTTAGTGGAGGGGACGAAATTTCGAACTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 15.60% 0.15% 0.06% NA
All Indica  2759 87.30% 12.50% 0.14% 0.11% NA
All Japonica  1512 75.30% 24.70% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 90.90% 8.70% 0.17% 0.17% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 83.70% 16.30% 0.00% 0.00% NA
Indica Intermediate  786 83.70% 15.60% 0.38% 0.25% NA
Temperate Japonica  767 63.40% 36.50% 0.13% 0.00% NA
Tropical Japonica  504 86.30% 13.70% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720679202 T -> DEL N N silent_mutation Average:64.721; most accessible tissue: Callus, score: 89.021 N N N N
vg0720679202 T -> C LOC_Os07g34510.1 upstream_gene_variant ; 1952.0bp to feature; MODIFIER silent_mutation Average:64.721; most accessible tissue: Callus, score: 89.021 N N N N
vg0720679202 T -> C LOC_Os07g34500.1 downstream_gene_variant ; 1656.0bp to feature; MODIFIER silent_mutation Average:64.721; most accessible tissue: Callus, score: 89.021 N N N N
vg0720679202 T -> C LOC_Os07g34500-LOC_Os07g34510 intergenic_region ; MODIFIER silent_mutation Average:64.721; most accessible tissue: Callus, score: 89.021 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720679202 NA 6.08E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 4.67E-06 4.67E-06 mr1048 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 5.41E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 3.25E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 6.18E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 3.42E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 3.79E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 6.23E-06 mr1555 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 3.87E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 9.20E-06 mr1654 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 1.02E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202 NA 9.33E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251