Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720679202:

Variant ID: vg0720679202 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20679202
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGTTCGAAATTTCGTCCCCTCCACTAAGCAAATATCTCACCTGAACTTTTTGAGTTTTCTATTTGTTGGATTTGACCAAACCTAGTCTACGAAGATGTT[T/C]
ATAGGGATAAGATTTGAGTGAGTGCGTTCATAGGGGTGAGTGCGTGCGTTGTGAGTGACTGCGTTGCACTGTGTAATTTAAAAAAATATATTAAAATTCA

Reverse complement sequence

TGAATTTTAATATATTTTTTTAAATTACACAGTGCAACGCAGTCACTCACAACGCACGCACTCACCCCTATGAACGCACTCACTCAAATCTTATCCCTAT[A/G]
AACATCTTCGTAGACTAGGTTTGGTCAAATCCAACAAATAGAAAACTCAAAAAGTTCAGGTGAGATATTTGCTTAGTGGAGGGGACGAAATTTCGAACTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.20%	15.60%	0.15%	0.06%	NA
All Indica	2759	87.30%	12.50%	0.14%	0.11%	NA
All Japonica	1512	75.30%	24.70%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	90.90%	8.70%	0.17%	0.17%	NA
Indica II	465	95.70%	4.30%	0.00%	0.00%	NA
Indica III	913	83.70%	16.30%	0.00%	0.00%	NA
Indica Intermediate	786	83.70%	15.60%	0.38%	0.25%	NA
Temperate Japonica	767	63.40%	36.50%	0.13%	0.00%	NA
Tropical Japonica	504	86.30%	13.70%	0.00%	0.00%	NA
Japonica Intermediate	241	90.00%	10.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	21.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720679202	T -> DEL	N	N	silent_mutation	Average:64.721; most accessible tissue: Callus, score: 89.021	N	N	N	N
vg0720679202	T -> C	LOC_Os07g34510.1	upstream_gene_variant ; 1952.0bp to feature; MODIFIER	silent_mutation	Average:64.721; most accessible tissue: Callus, score: 89.021	N	N	N	N
vg0720679202	T -> C	LOC_Os07g34500.1	downstream_gene_variant ; 1656.0bp to feature; MODIFIER	silent_mutation	Average:64.721; most accessible tissue: Callus, score: 89.021	N	N	N	N
vg0720679202	T -> C	LOC_Os07g34500-LOC_Os07g34510	intergenic_region ; MODIFIER	silent_mutation	Average:64.721; most accessible tissue: Callus, score: 89.021	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720679202	NA	6.08E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	4.67E-06	4.67E-06	mr1048	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	5.41E-06	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	3.25E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	6.18E-07	mr1289	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	3.42E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	3.79E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	6.23E-06	mr1555	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	3.87E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	9.20E-06	mr1654	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	1.02E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720679202	NA	9.33E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251