\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720674612:

Variant ID: vg0720674612 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20674612
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAAGGAACGGTTCCGCATAACAGCGGTGGACGCCGTAGGGTTTCTGACAGCTCCAAGGAAAATATTGAGCCGATTTAGGTCTATCTGCGGGGTCATAG[A/G]
GAGGCAGAAATTCAGTATTCTGCAAGACGACTTCAAGCTCGTGCCGGCCGCAGAGAAGGACATTGCTTGGCTAACGTTCAAGGAGAGCTTTGATTATCCT

Reverse complement sequence

AGGATAATCAAAGCTCTCCTTGAACGTTAGCCAAGCAATGTCCTTCTCTGCGGCCGGCACGAGCTTGAAGTCGTCTTGCAGAATACTGAATTTCTGCCTC[T/C]
CTATGACCCCGCAGATAGACCTAAATCGGCTCAATATTTTCCTTGGAGCTGTCAGAAACCCTACGGCGTCCACCGCTGTTATGCGGAACCGTTCCTTAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 9.80% 2.10% 12.46% 75.56% NA
All Indica  2759 1.60% 0.00% 13.99% 84.38% NA
All Japonica  1512 22.40% 6.50% 5.62% 65.48% NA
Aus  269 1.50% 0.00% 34.57% 63.94% NA
Indica I  595 1.00% 0.00% 6.55% 92.44% NA
Indica II  465 2.80% 0.00% 9.03% 88.17% NA
Indica III  913 1.40% 0.00% 20.59% 77.98% NA
Indica Intermediate  786 1.50% 0.10% 14.89% 83.46% NA
Temperate Japonica  767 39.20% 12.60% 4.17% 43.94% NA
Tropical Japonica  504 2.00% 0.00% 5.75% 92.26% NA
Japonica Intermediate  241 11.20% 0.80% 9.96% 78.01% NA
VI/Aromatic  96 61.50% 1.00% 13.54% 23.96% NA
Intermediate  90 22.20% 0.00% 13.33% 64.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720674612 A -> DEL LOC_Os07g34500.1 N frameshift_variant Average:13.528; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0720674612 A -> G LOC_Os07g34500.1 missense_variant ; p.Glu54Gly; MODERATE nonsynonymous_codon ; E54G Average:13.528; most accessible tissue: Minghui63 panicle, score: 25.313 probably damaging -2.107 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720674612 NA 6.55E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 9.90E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 9.11E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 3.87E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 7.17E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 2.55E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 6.34E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 9.69E-06 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 3.96E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 5.15E-08 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 9.70E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 4.17E-06 mr1555 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 6.30E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 8.72E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 9.53E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 2.33E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 7.67E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 2.53E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 3.52E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 2.02E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 1.08E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 4.61E-06 1.35E-10 mr1880_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720674612 NA 1.41E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251