| Variant ID: vg0720634569 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20634569 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.15, others allele: 0.00, population size: 94. )
GGTTTGAAAGCTCAGAGGAATTTTTTGATCTTTAGTACCGGTTGGTGTTACCAACCGGGACTAAAGATCTATTTATAGTCCCGGTTGGTAACACCAACTG[A/G]
GAAAAAAGATCGATATAAGCTTTACTTTCGGTTGATGTTACCAACCGGGACGAAAGATATATTTTTAGAACACCAACCGGGAAAAAAGTCAACATAAGCG
CGCTTATGTTGACTTTTTTCCCGGTTGGTGTTCTAAAAATATATCTTTCGTCCCGGTTGGTAACATCAACCGAAAGTAAAGCTTATATCGATCTTTTTTC[T/C]
CAGTTGGTGTTACCAACCGGGACTATAAATAGATCTTTAGTCCCGGTTGGTAACACCAACCGGTACTAAAGATCAAAAAATTCCTCTGAGCTTTCAAACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 18.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 2.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 66.80% | 33.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 6.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 46.80% | 53.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.60% | 15.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 4.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720634569 | A -> G | LOC_Os07g34400-LOC_Os07g34410 | intergenic_region ; MODIFIER | silent_mutation | Average:56.204; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720634569 | NA | 2.44E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0720634569 | NA | 2.42E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720634569 | NA | 3.78E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720634569 | NA | 1.68E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720634569 | NA | 9.90E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720634569 | NA | 1.85E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720634569 | NA | 4.54E-07 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720634569 | NA | 5.62E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720634569 | NA | 3.20E-16 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720634569 | NA | 3.68E-06 | mr1149 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/