| Variant ID: vg0720602295 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20602295 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCATTCAGAGAGTACAATGCAGGCATCAACTTCGGGCCTATTTGGTAGAGTTCCAACTCCTAAATTTAGCTACAGGAGTTGAGTCTGCAGTGGAGTTGTG[G/A]
AGCTGCCTGAACCTAGCTTCACCTCTCTAGTTTATTTTATGAGAGAGATCCATCTAGCTCCACTTACATTTTAAGTGGAGCTGAAACTGTTTGGATGAGC
GCTCATCCAAACAGTTTCAGCTCCACTTAAAATGTAAGTGGAGCTAGATGGATCTCTCTCATAAAATAAACTAGAGAGGTGAAGCTAGGTTCAGGCAGCT[C/T]
CACAACTCCACTGCAGACTCAACTCCTGTAGCTAAATTTAGGAGTTGGAACTCTACCAAATAGGCCCGAAGTTGATGCCTGCATTGTACTCTCTGAATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 10.60% | 0.06% | 0.25% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 66.70% | 32.30% | 0.20% | 0.79% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 69.90% | 28.30% | 0.26% | 1.56% | NA |
| Tropical Japonica | 504 | 73.80% | 26.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.90% | 57.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720602295 | G -> DEL | N | N | silent_mutation | Average:62.535; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0720602295 | G -> A | LOC_Os07g34370.1 | upstream_gene_variant ; 2091.0bp to feature; MODIFIER | silent_mutation | Average:62.535; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0720602295 | G -> A | LOC_Os07g34380.1 | downstream_gene_variant ; 366.0bp to feature; MODIFIER | silent_mutation | Average:62.535; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0720602295 | G -> A | LOC_Os07g34370-LOC_Os07g34380 | intergenic_region ; MODIFIER | silent_mutation | Average:62.535; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720602295 | NA | 1.76E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0720602295 | NA | 4.04E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720602295 | NA | 6.02E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720602295 | NA | 2.79E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720602295 | NA | 2.56E-06 | mr1836_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720602295 | 2.31E-06 | 2.31E-06 | mr1908_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |