\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720597280:

Variant ID: vg0720597280 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20597280
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCCTCCGACTCCACAAGCGTCACGAATGGCCAGAGCGTGTCCACCTTGTACTGTACGGGGGGAACGCCGAGTCGCCGACACTGGAGCGCGGCCCACGC[T/A]
TCGTCGTACGCCGCCGGTATGGGATGCTCCGGCGCGAGGCGGTACTCGACGGACACGACGAGCGCCCCGGTGCGCGAGGCGAGGGAGGTGGCGTAGCGGT

Reverse complement sequence

ACCGCTACGCCACCTCCCTCGCCTCGCGCACCGGGGCGCTCGTCGTGTCCGTCGAGTACCGCCTCGCGCCGGAGCATCCCATACCGGCGGCGTACGACGA[A/T]
GCGTGGGCCGCGCTCCAGTGTCGGCGACTCGGCGTTCCCCCCGTACAGTACAAGGTGGACACGCTCTGGCCATTCGTGACGCTTGTGGAGTCGGAGGGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 16.00% 0.53% 8.82% NA
All Indica  2759 98.60% 1.10% 0.11% 0.14% NA
All Japonica  1512 24.70% 47.00% 1.39% 26.85% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.60% 2.20% 0.22% 0.00% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 97.30% 2.20% 0.25% 0.25% NA
Temperate Japonica  767 2.30% 81.90% 2.61% 13.17% NA
Tropical Japonica  504 62.10% 5.00% 0.20% 32.74% NA
Japonica Intermediate  241 17.80% 24.10% 0.00% 58.09% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 15.60% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720597280 T -> DEL LOC_Os07g34370.1 N frameshift_variant Average:78.744; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0720597280 T -> A LOC_Os07g34370.1 missense_variant ; p.Glu507Asp; MODERATE nonsynonymous_codon ; E507D Average:78.744; most accessible tissue: Zhenshan97 panicle, score: 89.389 benign -0.798 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0720597280 T A -0.02 0.0 -0.01 0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720597280 NA 1.17E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 2.18E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 5.24E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 5.98E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 9.75E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 4.35E-06 NA mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 8.76E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 3.48E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 5.36E-08 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 3.80E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720597280 NA 4.25E-07 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251