\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720593494:

Variant ID: vg0720593494 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20593494
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATACCTTTAATCATTAAAAAAATAGTAAGAGTGATTGGTAGGTAAATGATATTAAAGGAATAAAACTTCTCGTTTTACGTGCTGAGGGTAGGTGGGAG[A/G]
GTAGAAGTTGTTTTTTTTGACAAAATTCAAGCTCTAGAAGTTGAGTTTTTTTAAGGACTGAGTGAGTAGGCATCAAAATCACTCATCGTAGCATACATGA

Reverse complement sequence

TCATGTATGCTACGATGAGTGATTTTGATGCCTACTCACTCAGTCCTTAAAAAAACTCAACTTCTAGAGCTTGAATTTTGTCAAAAAAAACAACTTCTAC[T/C]
CTCCCACCTACCCTCAGCACGTAAAACGAGAAGTTTTATTCCTTTAATATCATTTACCTACCAATCACTCTTACTATTTTTTTAATGATTAAAGGTATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 13.30% 0.04% 0.25% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 60.20% 38.90% 0.13% 0.79% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 31.80% 66.40% 0.26% 1.56% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 77.60% 22.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720593494 A -> DEL N N silent_mutation Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0720593494 A -> G LOC_Os07g34360.1 upstream_gene_variant ; 2390.0bp to feature; MODIFIER silent_mutation Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0720593494 A -> G LOC_Os07g34350.1 downstream_gene_variant ; 4782.0bp to feature; MODIFIER silent_mutation Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0720593494 A -> G LOC_Os07g34370.1 downstream_gene_variant ; 3258.0bp to feature; MODIFIER silent_mutation Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0720593494 A -> G LOC_Os07g34360-LOC_Os07g34370 intergenic_region ; MODIFIER silent_mutation Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720593494 NA 9.82E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 7.92E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 1.06E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 3.67E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 4.71E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 3.46E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 5.20E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 9.46E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 3.34E-16 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 8.05E-09 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 5.58E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 1.86E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 1.55E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 6.88E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 1.75E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 5.40E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 2.45E-08 NA mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 3.04E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494 NA 9.46E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251