Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720593494:

Variant ID: vg0720593494 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20593494
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATACCTTTAATCATTAAAAAAATAGTAAGAGTGATTGGTAGGTAAATGATATTAAAGGAATAAAACTTCTCGTTTTACGTGCTGAGGGTAGGTGGGAG[A/G]
GTAGAAGTTGTTTTTTTTGACAAAATTCAAGCTCTAGAAGTTGAGTTTTTTTAAGGACTGAGTGAGTAGGCATCAAAATCACTCATCGTAGCATACATGA

Reverse complement sequence

TCATGTATGCTACGATGAGTGATTTTGATGCCTACTCACTCAGTCCTTAAAAAAACTCAACTTCTAGAGCTTGAATTTTGTCAAAAAAAACAACTTCTAC[T/C]
CTCCCACCTACCCTCAGCACGTAAAACGAGAAGTTTTATTCCTTTAATATCATTTACCTACCAATCACTCTTACTATTTTTTTAATGATTAAAGGTATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.40%	13.30%	0.04%	0.25%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	60.20%	38.90%	0.13%	0.79%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	2.00%	0.00%	0.00%	NA
Temperate Japonica	767	31.80%	66.40%	0.26%	1.56%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	77.60%	22.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720593494	A -> DEL	N	N	silent_mutation	Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0720593494	A -> G	LOC_Os07g34360.1	upstream_gene_variant ; 2390.0bp to feature; MODIFIER	silent_mutation	Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0720593494	A -> G	LOC_Os07g34350.1	downstream_gene_variant ; 4782.0bp to feature; MODIFIER	silent_mutation	Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0720593494	A -> G	LOC_Os07g34370.1	downstream_gene_variant ; 3258.0bp to feature; MODIFIER	silent_mutation	Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0720593494	A -> G	LOC_Os07g34360-LOC_Os07g34370	intergenic_region ; MODIFIER	silent_mutation	Average:55.447; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720593494	NA	9.82E-06	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	7.92E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	1.06E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	3.67E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	4.71E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	3.46E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	5.20E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	9.46E-09	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	3.34E-16	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	8.05E-09	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	5.58E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	1.86E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	1.55E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	6.88E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	1.75E-07	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	5.40E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	2.45E-08	NA	mr1691_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	3.04E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720593494	NA	9.46E-09	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251