\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720545035:

Variant ID: vg0720545035 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20545035
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCATGGTTAAATGAGAGTAAAAGTTGTACTTACGGTGGGGTCGATAAATCTCAAACATCCATATTTACATCTTATGATAGTATGTAGGTTTCCACTA[C/T]
ATATGATTCTTGTAGAGTAAATTTACTATCCCACCTTGTAGAATTTTACTATTTGAATCCTGACATGTGCCCATTTGCCACCAGTCCTAATTGAAATTTT

Reverse complement sequence

AAAATTTCAATTAGGACTGGTGGCAAATGGGCACATGTCAGGATTCAAATAGTAAAATTCTACAAGGTGGGATAGTAAATTTACTCTACAAGAATCATAT[G/A]
TAGTGGAAACCTACATACTATCATAAGATGTAAATATGGATGTTTGAGATTTATCGACCCCACCGTAAGTACAACTTTTACTCTCATTTAACCATGAGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 5.50% 1.63% 0.30% NA
All Indica  2759 99.80% 0.20% 0.04% 0.00% NA
All Japonica  1512 77.70% 16.50% 4.96% 0.86% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 86.70% 4.30% 7.30% 1.69% NA
Tropical Japonica  504 74.60% 25.00% 0.40% 0.00% NA
Japonica Intermediate  241 55.60% 37.30% 7.05% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720545035 C -> DEL N N silent_mutation Average:31.625; most accessible tissue: Callus, score: 71.695 N N N N
vg0720545035 C -> T LOC_Os07g34300.1 downstream_gene_variant ; 1076.0bp to feature; MODIFIER silent_mutation Average:31.625; most accessible tissue: Callus, score: 71.695 N N N N
vg0720545035 C -> T LOC_Os07g34290-LOC_Os07g34300 intergenic_region ; MODIFIER silent_mutation Average:31.625; most accessible tissue: Callus, score: 71.695 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720545035 9.36E-07 4.50E-13 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0720545035 1.31E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 5.55E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 6.38E-07 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 4.95E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 7.20E-07 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 6.21E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 1.08E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 8.54E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 7.72E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 NA 4.35E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720545035 3.88E-06 6.38E-09 mr1947_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251