\
| Variant ID: vg0720545035 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20545035 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 286. )
TACTCATGGTTAAATGAGAGTAAAAGTTGTACTTACGGTGGGGTCGATAAATCTCAAACATCCATATTTACATCTTATGATAGTATGTAGGTTTCCACTA[C/T]
ATATGATTCTTGTAGAGTAAATTTACTATCCCACCTTGTAGAATTTTACTATTTGAATCCTGACATGTGCCCATTTGCCACCAGTCCTAATTGAAATTTT
AAAATTTCAATTAGGACTGGTGGCAAATGGGCACATGTCAGGATTCAAATAGTAAAATTCTACAAGGTGGGATAGTAAATTTACTCTACAAGAATCATAT[G/A]
TAGTGGAAACCTACATACTATCATAAGATGTAAATATGGATGTTTGAGATTTATCGACCCCACCGTAAGTACAACTTTTACTCTCATTTAACCATGAGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 5.50% | 1.63% | 0.30% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 77.70% | 16.50% | 4.96% | 0.86% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 86.70% | 4.30% | 7.30% | 1.69% | NA |
| Tropical Japonica | 504 | 74.60% | 25.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.60% | 37.30% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720545035 | C -> DEL | N | N | silent_mutation | Average:31.625; most accessible tissue: Callus, score: 71.695 | N | N | N | N |
| vg0720545035 | C -> T | LOC_Os07g34300.1 | downstream_gene_variant ; 1076.0bp to feature; MODIFIER | silent_mutation | Average:31.625; most accessible tissue: Callus, score: 71.695 | N | N | N | N |
| vg0720545035 | C -> T | LOC_Os07g34290-LOC_Os07g34300 | intergenic_region ; MODIFIER | silent_mutation | Average:31.625; most accessible tissue: Callus, score: 71.695 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720545035 | 9.36E-07 | 4.50E-13 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0720545035 | 1.31E-06 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 5.55E-08 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 6.38E-07 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 4.95E-06 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 7.20E-07 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 6.21E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 1.08E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 8.54E-06 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 7.72E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | NA | 4.35E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720545035 | 3.88E-06 | 6.38E-09 | mr1947_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |