\
| Variant ID: vg0720520611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20520611 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 53. )
GAGATTTAACGTGGAAAAACCCTCCCAAAGTAGGAGAAAAAAAAACACTGGCGCCAGCCAGCAAAATATCTTCACTATATCGGGGTGAGGTACGCCGAAC[G/A]
ACGGCTTACAAAAAGTATATATAAAGGTAAAACCCTAAAGTATAACAATCCATATTTATTATGTGCAAATAAATTTGCATCACAACTCAATATGCAAATC
GATTTGCATATTGAGTTGTGATGCAAATTTATTTGCACATAATAAATATGGATTGTTATACTTTAGGGTTTTACCTTTATATATACTTTTTGTAAGCCGT[C/T]
GTTCGGCGTACCTCACCCCGATATAGTGAAGATATTTTGCTGGCTGGCGCCAGTGTTTTTTTTTCTCCTACTTTGGGAGGGTTTTTCCACGTTAAATCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.50% | 2.30% | 4.32% | 60.92% | NA |
| All Indica | 2759 | 3.00% | 2.90% | 5.51% | 88.62% | NA |
| All Japonica | 1512 | 92.30% | 0.60% | 1.46% | 5.62% | NA |
| Aus | 269 | 0.40% | 5.20% | 5.20% | 89.22% | NA |
| Indica I | 595 | 1.20% | 2.20% | 1.18% | 95.46% | NA |
| Indica II | 465 | 4.90% | 1.10% | 2.80% | 91.18% | NA |
| Indica III | 913 | 0.80% | 4.70% | 10.73% | 83.79% | NA |
| Indica Intermediate | 786 | 5.90% | 2.30% | 4.33% | 87.53% | NA |
| Temperate Japonica | 767 | 97.40% | 0.10% | 1.83% | 0.65% | NA |
| Tropical Japonica | 504 | 83.30% | 1.40% | 1.59% | 13.69% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.40% | 0.00% | 4.56% | NA |
| VI/Aromatic | 96 | 11.50% | 4.20% | 8.33% | 76.04% | NA |
| Intermediate | 90 | 50.00% | 1.10% | 8.89% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720520611 | G -> DEL | N | N | silent_mutation | Average:25.129; most accessible tissue: Minghui63 flower, score: 38.402 | N | N | N | N |
| vg0720520611 | G -> A | LOC_Os07g34280.1 | upstream_gene_variant ; 3125.0bp to feature; MODIFIER | silent_mutation | Average:25.129; most accessible tissue: Minghui63 flower, score: 38.402 | N | N | N | N |
| vg0720520611 | G -> A | LOC_Os07g34270.1 | downstream_gene_variant ; 2689.0bp to feature; MODIFIER | silent_mutation | Average:25.129; most accessible tissue: Minghui63 flower, score: 38.402 | N | N | N | N |
| vg0720520611 | G -> A | LOC_Os07g34270-LOC_Os07g34280 | intergenic_region ; MODIFIER | silent_mutation | Average:25.129; most accessible tissue: Minghui63 flower, score: 38.402 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720520611 | NA | 3.74E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720520611 | NA | 3.34E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720520611 | NA | 2.98E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720520611 | 1.70E-06 | 1.70E-06 | mr1145 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720520611 | NA | 1.30E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720520611 | NA | 4.71E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720520611 | NA | 1.65E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720520611 | NA | 1.24E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |