Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720416740:

Variant ID: vg0720416740 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20416740
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CAACTTCAGTACCTTGCATCTATTATTCAGGTGCTTGATCCAAAGCTACATGACCACCTAGGTATAAATTTGAGATCAATGAAACTTTCAAACATTCAAC[C/T]
TTCTTCTCCAAAGTACCTACAATTTTTTAATATTGAGTTCTGAATGCAGAAATACTTGGTGGAGGTGATTATCTTTTTGCATTTCGTATGTTCATGGTGC

Reverse complement sequence

GCACCATGAACATACGAAATGCAAAAAGATAATCACCTCCACCAAGTATTTCTGCATTCAGAACTCAATATTAAAAAATTGTAGGTACTTTGGAGAAGAA[G/A]
GTTGAATGTTTGAAAGTTTCATTGATCTCAAATTTATACCTAGGTGGTCATGTAGCTTTGGATCAAGCACCTGAATAATAGATGCAAGGTACTGAAGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 20.40% 0.06% 0.00% NA
All Indica  2759 89.30% 10.60% 0.07% 0.00% NA
All Japonica  1512 73.90% 26.10% 0.07% 0.00% NA
Aus  269 8.20% 91.80% 0.00% 0.00% NA
Indica I  595 98.00% 1.70% 0.34% 0.00% NA
Indica II  465 89.90% 10.10% 0.00% 0.00% NA
Indica III  913 86.20% 13.80% 0.00% 0.00% NA
Indica Intermediate  786 86.10% 13.90% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 36.30% 63.70% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.40% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720416740 C -> T LOC_Os07g34140.1 downstream_gene_variant ; 3398.0bp to feature; MODIFIER silent_mutation Average:34.594; most accessible tissue: Callus, score: 62.765 N N N N
vg0720416740 C -> T LOC_Os07g34130.1 intron_variant ; MODIFIER silent_mutation Average:34.594; most accessible tissue: Callus, score: 62.765 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720416740 NA 1.93E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 2.53E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 4.61E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 3.69E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 1.53E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 4.17E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 6.50E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 1.50E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 8.40E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 9.76E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 7.05E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 4.11E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 4.18E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 4.36E-08 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 2.75E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 4.39E-12 mr1364_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 6.17E-09 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 1.14E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720416740 NA 1.71E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251