\
| Variant ID: vg0720401570 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20401570 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 200. )
AGAGCTCACTATTTATTATAAATTTATTGGGGCATTTGTAAATTTGCCATTGATTTTTTTCAATATTGCAAGGATGTCATTCGAATGATAGTTCTAGTGG[T/C]
ATTTTTGTAATTTTCTAGTATCAGTTTTGCAATAACGATTCAAATTAGTGGTAAATTTGCAATTGCCCCAAATTTATTATAGAGCTAACGTGTATAATTG
CAATTATACACGTTAGCTCTATAATAAATTTGGGGCAATTGCAAATTTACCACTAATTTGAATCGTTATTGCAAAACTGATACTAGAAAATTACAAAAAT[A/G]
CCACTAGAACTATCATTCGAATGACATCCTTGCAATATTGAAAAAAATCAATGGCAAATTTACAAATGCCCCAATAAATTTATAATAAATAGTGAGCTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.80% | 14.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 30.50% | 69.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720401570 | T -> C | LOC_Os07g34120.1 | downstream_gene_variant ; 2818.0bp to feature; MODIFIER | silent_mutation | Average:56.494; most accessible tissue: Zhenshan97 flower, score: 74.953 | N | N | N | N |
| vg0720401570 | T -> C | LOC_Os07g34110-LOC_Os07g34120 | intergenic_region ; MODIFIER | silent_mutation | Average:56.494; most accessible tissue: Zhenshan97 flower, score: 74.953 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720401570 | NA | 6.43E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0720401570 | NA | 7.92E-14 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0720401570 | NA | 1.10E-16 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0720401570 | NA | 2.59E-15 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0720401570 | 3.25E-06 | NA | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | 2.33E-08 | NA | mr1549 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | NA | 6.56E-10 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | NA | 5.99E-06 | mr1740 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | 3.42E-07 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | NA | 1.06E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | NA | 2.89E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | NA | 1.18E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | NA | 5.47E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720401570 | NA | 1.06E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |