\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720364932:

Variant ID: vg0720364932 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20364932
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAAACAGTACATAGAGATGCAATTTTTTTTATTTTTATTTCATTTTTTTATATTTTTTTCACACTTAGGAGAACATAGGAACCAACCGTATAAAAAAT[A/G]
AACTCAAACGGATAAAATATGTGACTTGTAGAATTTTTTAGAACTCTACCGAAACGGACAAAATATGTCATCTATTAAAATAGGCGTAACTTTCTCATAC

Reverse complement sequence

GTATGAGAAAGTTACGCCTATTTTAATAGATGACATATTTTGTCCGTTTCGGTAGAGTTCTAAAAAATTCTACAAGTCACATATTTTATCCGTTTGAGTT[T/C]
ATTTTTTATACGGTTGGTTCCTATGTTCTCCTAAGTGTGAAAAAAATATAAAAAAATGAAATAAAAATAAAAAAAATTGCATCTCTATGTACTGTTTAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.50% 14.70% 31.49% 26.26% NA
All Indica  2759 6.20% 24.60% 39.47% 29.65% NA
All Japonica  1512 70.00% 0.10% 14.09% 15.81% NA
Aus  269 14.10% 3.70% 44.61% 37.55% NA
Indica I  595 3.00% 15.50% 48.40% 33.11% NA
Indica II  465 4.70% 16.80% 38.49% 40.00% NA
Indica III  913 7.60% 36.00% 33.41% 23.00% NA
Indica Intermediate  786 8.00% 23.00% 40.33% 28.63% NA
Temperate Japonica  767 96.90% 0.00% 1.56% 1.56% NA
Tropical Japonica  504 27.80% 0.00% 35.71% 36.51% NA
Japonica Intermediate  241 73.00% 0.40% 8.71% 17.84% NA
VI/Aromatic  96 3.10% 0.00% 35.42% 61.46% NA
Intermediate  90 32.20% 5.60% 35.56% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720364932 A -> DEL N N silent_mutation Average:8.405; most accessible tissue: Callus, score: 23.117 N N N N
vg0720364932 A -> G LOC_Os07g34070.1 downstream_gene_variant ; 698.0bp to feature; MODIFIER silent_mutation Average:8.405; most accessible tissue: Callus, score: 23.117 N N N N
vg0720364932 A -> G LOC_Os07g34060-LOC_Os07g34070 intergenic_region ; MODIFIER silent_mutation Average:8.405; most accessible tissue: Callus, score: 23.117 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720364932 1.51E-06 2.15E-07 mr1024_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 NA 7.72E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 NA 5.76E-06 mr1230_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 NA 1.68E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 NA 4.30E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 NA 5.30E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 NA 8.03E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 NA 9.72E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 2.89E-06 2.89E-06 mr1424_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 1.80E-07 1.80E-07 mr1529_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720364932 NA 7.41E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251