\
| Variant ID: vg0720364932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20364932 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 72. )
GTTAAACAGTACATAGAGATGCAATTTTTTTTATTTTTATTTCATTTTTTTATATTTTTTTCACACTTAGGAGAACATAGGAACCAACCGTATAAAAAAT[A/G]
AACTCAAACGGATAAAATATGTGACTTGTAGAATTTTTTAGAACTCTACCGAAACGGACAAAATATGTCATCTATTAAAATAGGCGTAACTTTCTCATAC
GTATGAGAAAGTTACGCCTATTTTAATAGATGACATATTTTGTCCGTTTCGGTAGAGTTCTAAAAAATTCTACAAGTCACATATTTTATCCGTTTGAGTT[T/C]
ATTTTTTATACGGTTGGTTCCTATGTTCTCCTAAGTGTGAAAAAAATATAAAAAAATGAAATAAAAATAAAAAAAATTGCATCTCTATGTACTGTTTAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.50% | 14.70% | 31.49% | 26.26% | NA |
| All Indica | 2759 | 6.20% | 24.60% | 39.47% | 29.65% | NA |
| All Japonica | 1512 | 70.00% | 0.10% | 14.09% | 15.81% | NA |
| Aus | 269 | 14.10% | 3.70% | 44.61% | 37.55% | NA |
| Indica I | 595 | 3.00% | 15.50% | 48.40% | 33.11% | NA |
| Indica II | 465 | 4.70% | 16.80% | 38.49% | 40.00% | NA |
| Indica III | 913 | 7.60% | 36.00% | 33.41% | 23.00% | NA |
| Indica Intermediate | 786 | 8.00% | 23.00% | 40.33% | 28.63% | NA |
| Temperate Japonica | 767 | 96.90% | 0.00% | 1.56% | 1.56% | NA |
| Tropical Japonica | 504 | 27.80% | 0.00% | 35.71% | 36.51% | NA |
| Japonica Intermediate | 241 | 73.00% | 0.40% | 8.71% | 17.84% | NA |
| VI/Aromatic | 96 | 3.10% | 0.00% | 35.42% | 61.46% | NA |
| Intermediate | 90 | 32.20% | 5.60% | 35.56% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720364932 | A -> DEL | N | N | silent_mutation | Average:8.405; most accessible tissue: Callus, score: 23.117 | N | N | N | N |
| vg0720364932 | A -> G | LOC_Os07g34070.1 | downstream_gene_variant ; 698.0bp to feature; MODIFIER | silent_mutation | Average:8.405; most accessible tissue: Callus, score: 23.117 | N | N | N | N |
| vg0720364932 | A -> G | LOC_Os07g34060-LOC_Os07g34070 | intergenic_region ; MODIFIER | silent_mutation | Average:8.405; most accessible tissue: Callus, score: 23.117 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720364932 | 1.51E-06 | 2.15E-07 | mr1024_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | NA | 7.72E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | NA | 5.76E-06 | mr1230_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | NA | 1.68E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | NA | 4.30E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | NA | 5.30E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | NA | 8.03E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | NA | 9.72E-06 | mr1306_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | 2.89E-06 | 2.89E-06 | mr1424_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | 1.80E-07 | 1.80E-07 | mr1529_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720364932 | NA | 7.41E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |