\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720354763:

Variant ID: vg0720354763 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20354763
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTATTCTATTAATTCTATTAAGCCCTGGGCCGGAATGTTACACGCTGCCACGGAGGAACAAGGTCGCGAGGAGGAGGAAGAGGGCGAGAACATTTTC[G/A]
CCGTGCGCGCGCGAGATGGAGAGATGAGCGCGATTGGGAATAAAATTCGCTCCCCAGAAGTGAGGTACGATATATCCAGAGTTGAGAACCAGATCTATTG

Reverse complement sequence

CAATAGATCTGGTTCTCAACTCTGGATATATCGTACCTCACTTCTGGGGAGCGAATTTTATTCCCAATCGCGCTCATCTCTCCATCTCGCGCGCGCACGG[C/T]
GAAAATGTTCTCGCCCTCTTCCTCCTCCTCGCGACCTTGTTCCTCCGTGGCAGCGTGTAACATTCCGGCCCAGGGCTTAATAGAATTAATAGAATACTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 10.60% 0.11% 2.14% NA
All Indica  2759 97.10% 2.90% 0.00% 0.00% NA
All Japonica  1512 66.50% 26.60% 0.33% 6.55% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 94.10% 5.90% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 14.70% 65.10% 0.99% 19.25% NA
Japonica Intermediate  241 76.80% 22.40% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720354763 G -> DEL N N silent_mutation Average:56.52; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0720354763 G -> A LOC_Os07g34050.1 downstream_gene_variant ; 3173.0bp to feature; MODIFIER silent_mutation Average:56.52; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0720354763 G -> A LOC_Os07g34060.1 downstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:56.52; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0720354763 G -> A LOC_Os07g34060-LOC_Os07g34070 intergenic_region ; MODIFIER silent_mutation Average:56.52; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720354763 NA 1.03E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 8.26E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 6.35E-21 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 7.68E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 1.37E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 1.88E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 2.16E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 5.31E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 9.37E-10 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 8.75E-24 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 6.62E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 1.83E-11 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 1.35E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 1.42E-07 NA mr1563_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 2.82E-11 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763 NA 1.14E-14 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251