Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720354763:

Variant ID: vg0720354763 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20354763
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGTATTCTATTAATTCTATTAAGCCCTGGGCCGGAATGTTACACGCTGCCACGGAGGAACAAGGTCGCGAGGAGGAGGAAGAGGGCGAGAACATTTTC[G/A]
CCGTGCGCGCGCGAGATGGAGAGATGAGCGCGATTGGGAATAAAATTCGCTCCCCAGAAGTGAGGTACGATATATCCAGAGTTGAGAACCAGATCTATTG

Reverse complement sequence

CAATAGATCTGGTTCTCAACTCTGGATATATCGTACCTCACTTCTGGGGAGCGAATTTTATTCCCAATCGCGCTCATCTCTCCATCTCGCGCGCGCACGG[C/T]
GAAAATGTTCTCGCCCTCTTCCTCCTCCTCGCGACCTTGTTCCTCCGTGGCAGCGTGTAACATTCCGGCCCAGGGCTTAATAGAATTAATAGAATACTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.10%	10.60%	0.11%	2.14%	NA
All Indica	2759	97.10%	2.90%	0.00%	0.00%	NA
All Japonica	1512	66.50%	26.60%	0.33%	6.55%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	94.10%	5.90%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	97.40%	2.60%	0.00%	0.00%	NA
Tropical Japonica	504	14.70%	65.10%	0.99%	19.25%	NA
Japonica Intermediate	241	76.80%	22.40%	0.00%	0.83%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720354763	G -> DEL	N	N	silent_mutation	Average:56.52; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg0720354763	G -> A	LOC_Os07g34050.1	downstream_gene_variant ; 3173.0bp to feature; MODIFIER	silent_mutation	Average:56.52; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg0720354763	G -> A	LOC_Os07g34060.1	downstream_gene_variant ; 953.0bp to feature; MODIFIER	silent_mutation	Average:56.52; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg0720354763	G -> A	LOC_Os07g34060-LOC_Os07g34070	intergenic_region ; MODIFIER	silent_mutation	Average:56.52; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720354763	NA	1.03E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	8.26E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	6.35E-21	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	7.68E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	1.37E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	1.88E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	2.16E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	5.31E-10	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	9.37E-10	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	8.75E-24	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	6.62E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	1.83E-11	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	1.35E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	1.42E-07	NA	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	2.82E-11	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720354763	NA	1.14E-14	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251