Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720257973:

Variant ID: vg0720257973 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20257973
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:

GATATGGTGGTCAGACCAAGCCTGTTTTCCACAAGAAGGTACTGTGACAGTTTATATATGATTATGCAGTGTTGTGTGTGACTCTCTGTTCATTAGAAAC[A/G]
TATGGTGTCATGATTGATGTATCAGTGCTATGTGTCTGTACAATGCATGTGGCAATAACCATCACGTAGTTTTAATTGCATGTGGCTTTCAGCTGTGCAT

Reverse complement sequence

ATGCACAGCTGAAAGCCACATGCAATTAAAACTACGTGATGGTTATTGCCACATGCATTGTACAGACACATAGCACTGATACATCAATCATGACACCATA[T/C]
GTTTCTAATGAACAGAGAGTCACACACAACACTGCATAATCATATATAAACTGTCACAGTACCTTCTTGTGGAAAACAGGCTTGGTCTGACCACCATATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.90%	0.20%	4.80%	23.09%	NA
All Indica	2759	78.40%	0.10%	2.21%	19.28%	NA
All Japonica	1512	69.40%	0.10%	9.85%	20.57%	NA
Aus	269	10.80%	0.70%	5.20%	83.27%	NA
Indica I	595	98.00%	0.00%	0.00%	2.02%	NA
Indica II	465	90.50%	0.00%	0.86%	8.60%	NA
Indica III	913	59.30%	0.30%	4.38%	36.04%	NA
Indica Intermediate	786	78.50%	0.10%	2.16%	19.21%	NA
Temperate Japonica	767	97.80%	0.00%	0.78%	1.43%	NA
Tropical Japonica	504	21.80%	0.20%	23.41%	54.56%	NA
Japonica Intermediate	241	78.80%	0.40%	10.37%	10.37%	NA
VI/Aromatic	96	93.80%	0.00%	1.04%	5.21%	NA
Intermediate	90	76.70%	0.00%	2.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720257973	A -> DEL	N	N	silent_mutation	Average:59.864; most accessible tissue: Minghui63 flower, score: 78.798	N	N	N	N
vg0720257973	A -> G	LOC_Os07g33850.2	downstream_gene_variant ; 4871.0bp to feature; MODIFIER	silent_mutation	Average:59.864; most accessible tissue: Minghui63 flower, score: 78.798	N	N	N	N
vg0720257973	A -> G	LOC_Os07g33860.1	intron_variant ; MODIFIER	silent_mutation	Average:59.864; most accessible tissue: Minghui63 flower, score: 78.798	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720257973	NA	1.24E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	3.46E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	3.10E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	6.19E-06	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	8.98E-06	mr1349	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	3.19E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	6.68E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	1.06E-11	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	2.16E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	2.04E-08	mr1787	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	2.69E-10	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	4.43E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	1.73E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973	NA	2.20E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251