\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720257973:

Variant ID: vg0720257973 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20257973
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


GATATGGTGGTCAGACCAAGCCTGTTTTCCACAAGAAGGTACTGTGACAGTTTATATATGATTATGCAGTGTTGTGTGTGACTCTCTGTTCATTAGAAAC[A/G]
TATGGTGTCATGATTGATGTATCAGTGCTATGTGTCTGTACAATGCATGTGGCAATAACCATCACGTAGTTTTAATTGCATGTGGCTTTCAGCTGTGCAT

Reverse complement sequence

ATGCACAGCTGAAAGCCACATGCAATTAAAACTACGTGATGGTTATTGCCACATGCATTGTACAGACACATAGCACTGATACATCAATCATGACACCATA[T/C]
GTTTCTAATGAACAGAGAGTCACACACAACACTGCATAATCATATATAAACTGTCACAGTACCTTCTTGTGGAAAACAGGCTTGGTCTGACCACCATATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 0.20% 4.80% 23.09% NA
All Indica  2759 78.40% 0.10% 2.21% 19.28% NA
All Japonica  1512 69.40% 0.10% 9.85% 20.57% NA
Aus  269 10.80% 0.70% 5.20% 83.27% NA
Indica I  595 98.00% 0.00% 0.00% 2.02% NA
Indica II  465 90.50% 0.00% 0.86% 8.60% NA
Indica III  913 59.30% 0.30% 4.38% 36.04% NA
Indica Intermediate  786 78.50% 0.10% 2.16% 19.21% NA
Temperate Japonica  767 97.80% 0.00% 0.78% 1.43% NA
Tropical Japonica  504 21.80% 0.20% 23.41% 54.56% NA
Japonica Intermediate  241 78.80% 0.40% 10.37% 10.37% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 76.70% 0.00% 2.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720257973 A -> DEL N N silent_mutation Average:59.864; most accessible tissue: Minghui63 flower, score: 78.798 N N N N
vg0720257973 A -> G LOC_Os07g33850.2 downstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:59.864; most accessible tissue: Minghui63 flower, score: 78.798 N N N N
vg0720257973 A -> G LOC_Os07g33860.1 intron_variant ; MODIFIER silent_mutation Average:59.864; most accessible tissue: Minghui63 flower, score: 78.798 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720257973 NA 1.24E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 3.46E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 3.10E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 6.19E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 8.98E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 3.19E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 6.68E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 1.06E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 2.16E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 2.04E-08 mr1787 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 2.69E-10 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 4.43E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 1.73E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720257973 NA 2.20E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251