\
| Variant ID: vg0720231838 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20231838 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTATAACTTATAGAGAAAATTCGATCTATAGCACAGGAAAAAACCCGGTACCAAAATATAGCAGAACAAATTTTCTACTTCGACTAAAAGCATAGGGCAC[A/C]
AATTTTCTTGCGATTCATACCACTTCCGTCACATTTGCCATCCAAACATGTGAGTTGACATGAAAAAAAAACTCATTTGCCCCTCTTCCCTCCGCTAGCG
CGCTAGCGGAGGGAAGAGGGGCAAATGAGTTTTTTTTTCATGTCAACTCACATGTTTGGATGGCAAATGTGACGGAAGTGGTATGAATCGCAAGAAAATT[T/G]
GTGCCCTATGCTTTTAGTCGAAGTAGAAAATTTGTTCTGCTATATTTTGGTACCGGGTTTTTTCCTGTGCTATAGATCGAATTTTCTCTATAAGTTATAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 34.60% | 65.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.90% | 96.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 84.50% | 15.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.80% | 72.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720231838 | A -> C | LOC_Os07g33790-LOC_Os07g33820 | intergenic_region ; MODIFIER | silent_mutation | Average:71.717; most accessible tissue: Minghui63 panicle, score: 87.238 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720231838 | NA | 5.54E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.97E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 4.10E-42 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.08E-11 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.95E-43 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 9.36E-12 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.29E-08 | mr1129 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 2.86E-10 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 2.40E-10 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 2.38E-39 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 5.91E-11 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.29E-07 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.55E-06 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 2.46E-11 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 2.21E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 3.53E-11 | mr1435 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.24E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 3.21E-11 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 3.40E-44 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 7.78E-09 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 2.94E-08 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.20E-20 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 8.56E-18 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 9.22E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.64E-10 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 7.44E-27 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 1.25E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | NA | 2.97E-40 | mr1805_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720231838 | 7.39E-06 | 6.60E-09 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |