\
| Variant ID: vg0720195420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20195420 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 55. )
CTTGACCACAAAACCCGGGTATGACCCGTCCCCCAACTTACGAAAACCGGGTAAACGTGGTCCCTCGGCGGTTTTGAAGGTGGTTTTGGCTGACGTGGCG[T/C]
CTACGTGGCTTGTTTGACTTGGTTTTCGTCCCACGTGCCATTGACGTGGCGCTTACGTGGCAATTATATCTCGGAAAAATAATAAAAAGCGTGGCCCCAC
GTGGGGCCACGCTTTTTATTATTTTTCCGAGATATAATTGCCACGTAAGCGCCACGTCAATGGCACGTGGGACGAAAACCAAGTCAAACAAGCCACGTAG[A/G]
CGCCACGTCAGCCAAAACCACCTTCAAAACCGCCGAGGGACCACGTTTACCCGGTTTTCGTAAGTTGGGGGACGGGTCATACCCGGGTTTTGTGGTCAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.60% | 11.00% | 0.57% | 47.82% | NA |
| All Indica | 2759 | 15.20% | 17.40% | 0.80% | 66.65% | NA |
| All Japonica | 1512 | 72.60% | 2.60% | 0.26% | 24.47% | NA |
| Aus | 269 | 97.40% | 0.00% | 0.00% | 2.60% | NA |
| Indica I | 595 | 12.30% | 19.00% | 1.51% | 67.23% | NA |
| Indica II | 465 | 16.80% | 4.90% | 0.43% | 77.85% | NA |
| Indica III | 913 | 11.30% | 26.30% | 0.66% | 61.77% | NA |
| Indica Intermediate | 786 | 21.00% | 13.10% | 0.64% | 65.27% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 0.13% | 3.26% | NA |
| Tropical Japonica | 504 | 33.50% | 7.50% | 0.60% | 58.33% | NA |
| Japonica Intermediate | 241 | 78.00% | 0.80% | 0.00% | 21.16% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 47.80% | 3.30% | 1.11% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720195420 | T -> DEL | N | N | silent_mutation | Average:84.431; most accessible tissue: Minghui63 young leaf, score: 94.991 | N | N | N | N |
| vg0720195420 | T -> C | LOC_Os07g33770.1 | upstream_gene_variant ; 442.0bp to feature; MODIFIER | silent_mutation | Average:84.431; most accessible tissue: Minghui63 young leaf, score: 94.991 | N | N | N | N |
| vg0720195420 | T -> C | LOC_Os07g33770-LOC_Os07g33780 | intergenic_region ; MODIFIER | silent_mutation | Average:84.431; most accessible tissue: Minghui63 young leaf, score: 94.991 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720195420 | NA | 1.06E-06 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 2.17E-08 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 1.32E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 4.26E-23 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 1.53E-07 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 5.97E-09 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 7.28E-08 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 4.68E-10 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 3.27E-14 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 5.18E-18 | mr1583 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 2.34E-14 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 1.21E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 8.07E-27 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 2.20E-17 | mr1540_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 3.24E-16 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 3.60E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 5.54E-18 | mr1732_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720195420 | NA | 5.86E-08 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |