Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720146822:

Variant ID: vg0720146822 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20146822
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GCATCGGCCTTGCGTTTCTCTAGCTGGTGGTTCTGTCAGATGGTAAGTTACTCCCTCCGTTTCAAAATGTTTGACACCATTGACTTTTTAATACGTGTTT[G/A]
ACCATTCGTCTTATTAAAAAAATTAAGTAATTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATAAACTTTCATGTACATATATAATTTTTCATA

Reverse complement sequence

TATGAAAAATTATATATGTACATGAAAGTTTATTTAACAATGAATCAAATGATATGAAAAGAATAAATAATTACTTAATTTTTTTAATAAGACGAATGGT[C/T]
AAACACGTATTAAAAAGTCAATGGTGTCAAACATTTTGAAACGGAGGGAGTAACTTACCATCTGACAGAACCACCAGCTAGAGAAACGCAAGGCCGATGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.80%	3.80%	0.36%	60.03%	NA
All Indica	2759	9.20%	2.40%	0.43%	88.04%	NA
All Japonica	1512	75.90%	7.10%	0.20%	16.87%	NA
Aus	269	97.00%	0.00%	0.00%	2.97%	NA
Indica I	595	12.10%	0.00%	0.17%	87.73%	NA
Indica II	465	4.70%	1.70%	0.65%	92.90%	NA
Indica III	913	2.70%	5.70%	0.66%	90.91%	NA
Indica Intermediate	786	17.00%	0.60%	0.25%	82.06%	NA
Temperate Japonica	767	96.30%	0.10%	0.00%	3.52%	NA
Tropical Japonica	504	45.00%	20.40%	0.60%	33.93%	NA
Japonica Intermediate	241	75.10%	1.20%	0.00%	23.65%	NA
VI/Aromatic	96	4.20%	5.20%	0.00%	90.62%	NA
Intermediate	90	31.10%	2.20%	2.22%	64.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720146822	G -> DEL	N	N	silent_mutation	Average:74.204; most accessible tissue: Callus, score: 87.001	N	N	N	N
vg0720146822	G -> A	LOC_Os07g33700.1	downstream_gene_variant ; 4378.0bp to feature; MODIFIER	silent_mutation	Average:74.204; most accessible tissue: Callus, score: 87.001	N	N	N	N
vg0720146822	G -> A	LOC_Os07g33710.1	downstream_gene_variant ; 2564.0bp to feature; MODIFIER	silent_mutation	Average:74.204; most accessible tissue: Callus, score: 87.001	N	N	N	N
vg0720146822	G -> A	LOC_Os07g33700-LOC_Os07g33710	intergenic_region ; MODIFIER	silent_mutation	Average:74.204; most accessible tissue: Callus, score: 87.001	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720146822	NA	8.96E-06	mr1070_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	NA	8.75E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	2.97E-08	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	NA	2.87E-09	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	3.37E-06	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	NA	2.54E-06	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	9.06E-07	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	NA	2.42E-07	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	1.24E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	4.77E-07	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	NA	7.16E-07	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	1.20E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	NA	5.86E-10	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	1.73E-06	NA	mr1233_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	7.42E-07	7.42E-07	mr1233_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	2.95E-06	4.00E-09	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720146822	2.47E-06	NA	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251