Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720103372:

Variant ID: vg0720103372 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20103372
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATTAGCATGTAATTAATTAAGTTTTAATTATTATAAACGTGAATATGTATTTATTTTATATTTTAAAGCAACTTTTATATAGAAGTTCTGACACGAAA[C/T]
AGTATAAAAAACGTGCTAAGAAAAATCAAGGTAAAATACTCCCTCCGTCCCATGATATAAGGGATTTTGAGTTTTTGCTTGCACTGTTTGACCACTCATC

Reverse complement sequence

GATGAGTGGTCAAACAGTGCAAGCAAAAACTCAAAATCCCTTATATCATGGGACGGAGGGAGTATTTTACCTTGATTTTTCTTAGCACGTTTTTTATACT[G/A]
TTTCGTGTCAGAACTTCTATATAAAAGTTGCTTTAAAATATAAAATAAATACATATTCACGTTTATAATAATTAAAACTTAATTAATTACATGCTAATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.40%	15.60%	6.03%	0.95%	NA
All Indica	2759	65.60%	22.60%	10.18%	1.59%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	56.80%	10.30%	29.75%	3.19%	NA
Indica II	465	78.10%	15.30%	3.87%	2.80%	NA
Indica III	913	62.20%	34.90%	2.52%	0.33%	NA
Indica Intermediate	786	68.80%	22.00%	8.02%	1.15%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	74.40%	21.10%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720103372	C -> DEL	N	N	silent_mutation	Average:37.267; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0720103372	C -> T	LOC_Os07g33650.1	upstream_gene_variant ; 3440.0bp to feature; MODIFIER	silent_mutation	Average:37.267; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0720103372	C -> T	LOC_Os07g33650.3	upstream_gene_variant ; 3435.0bp to feature; MODIFIER	silent_mutation	Average:37.267; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0720103372	C -> T	LOC_Os07g33650.2	upstream_gene_variant ; 3440.0bp to feature; MODIFIER	silent_mutation	Average:37.267; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0720103372	C -> T	LOC_Os07g33640.1	downstream_gene_variant ; 4572.0bp to feature; MODIFIER	silent_mutation	Average:37.267; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N
vg0720103372	C -> T	LOC_Os07g33640-LOC_Os07g33650	intergenic_region ; MODIFIER	silent_mutation	Average:37.267; most accessible tissue: Minghui63 root, score: 67.73	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720103372	4.51E-06	NA	mr1435	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251