\
| Variant ID: vg0720078741 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20078741 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCATTTTGTGCACAGGCACATATATAGAACTGGAGTTAACCTTTTCTGACCACTAAGTATGTAATTTGCTTCTAATTTTTGAAATGTCTACCTGTTTTTC[T/C]
TGGCAGATATTCTGCATAATAATATGCCAAAAAAAAAGGATGTTTCCTGCATACATGGCCTGTGCCAAGGCTAAAACTATACTTGTCGATTGAGAGTCCT
AGGACTCTCAATCGACAAGTATAGTTTTAGCCTTGGCACAGGCCATGTATGCAGGAAACATCCTTTTTTTTTGGCATATTATTATGCAGAATATCTGCCA[A/G]
GAAAAACAGGTAGACATTTCAAAAATTAGAAGCAAATTACATACTTAGTGGTCAGAAAAGGTTAACTCCAGTTCTATATATGTGCCTGTGCACAAAATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 20.60% | 0.32% | 25.58% | NA |
| All Indica | 2759 | 88.50% | 0.80% | 0.14% | 10.55% | NA |
| All Japonica | 1512 | 1.70% | 62.00% | 0.60% | 35.78% | NA |
| Aus | 269 | 4.50% | 0.00% | 0.00% | 95.54% | NA |
| Indica I | 595 | 90.10% | 0.30% | 0.17% | 9.41% | NA |
| Indica II | 465 | 84.30% | 2.20% | 0.22% | 13.33% | NA |
| Indica III | 913 | 94.40% | 0.10% | 0.11% | 5.37% | NA |
| Indica Intermediate | 786 | 82.80% | 1.30% | 0.13% | 15.78% | NA |
| Temperate Japonica | 767 | 1.40% | 93.70% | 0.26% | 4.56% | NA |
| Tropical Japonica | 504 | 1.80% | 12.10% | 0.99% | 85.12% | NA |
| Japonica Intermediate | 241 | 2.10% | 65.10% | 0.83% | 31.95% | NA |
| VI/Aromatic | 96 | 6.20% | 1.00% | 1.04% | 91.67% | NA |
| Intermediate | 90 | 47.80% | 15.60% | 1.11% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720078741 | T -> DEL | N | N | silent_mutation | Average:60.303; most accessible tissue: Zhenshan97 root, score: 90.023 | N | N | N | N |
| vg0720078741 | T -> C | LOC_Os07g33610.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.303; most accessible tissue: Zhenshan97 root, score: 90.023 | N | N | N | N |
| vg0720078741 | T -> C | LOC_Os07g33610.2 | intron_variant ; MODIFIER | silent_mutation | Average:60.303; most accessible tissue: Zhenshan97 root, score: 90.023 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720078741 | NA | 2.37E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | NA | 3.54E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | NA | 4.03E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | NA | 3.03E-31 | mr1224 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | NA | 3.13E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | 2.50E-06 | NA | mr1082_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | 8.56E-06 | NA | mr1103_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | NA | 9.56E-37 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | NA | 2.11E-07 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720078741 | NA | 1.17E-06 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |