\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720065275:

Variant ID: vg0720065275 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20065275
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.13, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTGAGACCAGAAGCCCCCCTTGAATATGCTCATGCTTAAAATGATCCACATGTTTCTGTCTATTACCATGCGTTTCAGTTTATGTTTTCTCCAGTTTA[G/A]
TTGAGGTGTCAAGAGTGTTGCAGGTATGAAGGCTGTGGTAAAGTTATTCAGAAATGGAGTGACTTAAGATCATTATGTAGAAAAATGTGGAATGGCCTAC

Reverse complement sequence

GTAGGCCATTCCACATTTTTCTACATAATGATCTTAAGTCACTCCATTTCTGAATAACTTTACCACAGCCTTCATACCTGCAACACTCTTGACACCTCAA[C/T]
TAAACTGGAGAAAACATAAACTGAAACGCATGGTAATAGACAGAAACATGTGGATCATTTTAAGCATGAGCATATTCAAGGGGGGCTTCTGGTCTCAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.40% 27.50% 2.77% 39.34% NA
All Indica  2759 17.00% 13.60% 4.53% 64.88% NA
All Japonica  1512 62.30% 34.90% 0.20% 2.65% NA
Aus  269 0.40% 97.00% 0.37% 2.23% NA
Indica I  595 2.50% 11.10% 4.71% 81.68% NA
Indica II  465 6.90% 16.60% 3.87% 72.69% NA
Indica III  913 33.70% 8.50% 4.27% 53.45% NA
Indica Intermediate  786 14.50% 19.60% 5.09% 60.81% NA
Temperate Japonica  767 94.10% 2.60% 0.26% 3.00% NA
Tropical Japonica  504 12.70% 87.30% 0.00% 0.00% NA
Japonica Intermediate  241 64.70% 27.80% 0.41% 7.05% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 24.40% 47.80% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720065275 G -> DEL N N silent_mutation Average:17.459; most accessible tissue: Callus, score: 73.813 N N N N
vg0720065275 G -> A LOC_Os07g33580.1 3_prime_UTR_variant ; 76.0bp to feature; MODIFIER silent_mutation Average:17.459; most accessible tissue: Callus, score: 73.813 N N N N
vg0720065275 G -> A LOC_Os07g33600.1 upstream_gene_variant ; 2278.0bp to feature; MODIFIER silent_mutation Average:17.459; most accessible tissue: Callus, score: 73.813 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720065275 NA 6.74E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 4.15E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 2.31E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.31E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 6.65E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 7.20E-12 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 2.58E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 2.51E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 7.89E-13 mr1435 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 2.83E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 7.26E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.26E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.78E-10 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 8.52E-09 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.09E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 6.14E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.33E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 6.38E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 7.47E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 6.54E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.00E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.99E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.19E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 7.91E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.17E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720065275 NA 1.69E-11 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251