\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720058754:

Variant ID: vg0720058754 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20058754
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAAGGTGTGTGTAGGATGGGTGAGCACCATAGAGGGCAAAAAACGGGGTGTGGTGATGAAGGGTTTTGGTGGGATGACGATTAATGAGATGTGTGGCA[G/A]
TATGGAGGGCCTCGACCCAAAAAGAAGGTGGTAGGCTAGCTTGAAACAGCAGGGAGCGAACTATGTTATTGAGAGAACGTAGCATGCGCTCGGCCTTACC

Reverse complement sequence

GGTAAGGCCGAGCGCATGCTACGTTCTCTCAATAACATAGTTCGCTCCCTGCTGTTTCAAGCTAGCCTACCACCTTCTTTTTGGGTCGAGGCCCTCCATA[C/T]
TGCCACACATCTCATTAATCGTCATCCCACCAAAACCCTTCATCACCACACCCCGTTTTTTGCCCTCTATGGTGCTCACCCATCCTACACACACCTTCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 17.90% 0.83% 30.09% NA
All Indica  2759 18.10% 30.30% 1.41% 50.24% NA
All Japonica  1512 99.30% 0.20% 0.00% 0.53% NA
Aus  269 95.90% 0.70% 0.00% 3.35% NA
Indica I  595 11.10% 39.70% 1.34% 47.90% NA
Indica II  465 19.80% 29.00% 1.29% 49.89% NA
Indica III  913 18.10% 27.60% 0.99% 53.34% NA
Indica Intermediate  786 22.40% 27.00% 2.04% 48.60% NA
Temperate Japonica  767 98.80% 0.30% 0.00% 0.91% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 4.40% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720058754 G -> DEL N N silent_mutation Average:33.635; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0720058754 G -> A LOC_Os07g33580.1 upstream_gene_variant ; 4640.0bp to feature; MODIFIER silent_mutation Average:33.635; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0720058754 G -> A LOC_Os07g33560.1 downstream_gene_variant ; 4709.0bp to feature; MODIFIER silent_mutation Average:33.635; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0720058754 G -> A LOC_Os07g33570.1 intron_variant ; MODIFIER silent_mutation Average:33.635; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720058754 5.60E-08 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754 2.63E-08 6.44E-13 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754 NA 5.08E-08 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754 NA 3.73E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754 NA 5.72E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754 NA 1.22E-09 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754 1.12E-06 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754 7.95E-07 6.80E-08 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251