Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0720058754:

Variant ID: vg0720058754 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20058754
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TCGAAGGTGTGTGTAGGATGGGTGAGCACCATAGAGGGCAAAAAACGGGGTGTGGTGATGAAGGGTTTTGGTGGGATGACGATTAATGAGATGTGTGGCA[G/A]
TATGGAGGGCCTCGACCCAAAAAGAAGGTGGTAGGCTAGCTTGAAACAGCAGGGAGCGAACTATGTTATTGAGAGAACGTAGCATGCGCTCGGCCTTACC

Reverse complement sequence

GGTAAGGCCGAGCGCATGCTACGTTCTCTCAATAACATAGTTCGCTCCCTGCTGTTTCAAGCTAGCCTACCACCTTCTTTTTGGGTCGAGGCCCTCCATA[C/T]
TGCCACACATCTCATTAATCGTCATCCCACCAAAACCCTTCATCACCACACCCCGTTTTTTGCCCTCTATGGTGCTCACCCATCCTACACACACCTTCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.20%	17.90%	0.83%	30.09%	NA
All Indica	2759	18.10%	30.30%	1.41%	50.24%	NA
All Japonica	1512	99.30%	0.20%	0.00%	0.53%	NA
Aus	269	95.90%	0.70%	0.00%	3.35%	NA
Indica I	595	11.10%	39.70%	1.34%	47.90%	NA
Indica II	465	19.80%	29.00%	1.29%	49.89%	NA
Indica III	913	18.10%	27.60%	0.99%	53.34%	NA
Indica Intermediate	786	22.40%	27.00%	2.04%	48.60%	NA
Temperate Japonica	767	98.80%	0.30%	0.00%	0.91%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	4.40%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720058754	G -> DEL	N	N	silent_mutation	Average:33.635; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0720058754	G -> A	LOC_Os07g33580.1	upstream_gene_variant ; 4640.0bp to feature; MODIFIER	silent_mutation	Average:33.635; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0720058754	G -> A	LOC_Os07g33560.1	downstream_gene_variant ; 4709.0bp to feature; MODIFIER	silent_mutation	Average:33.635; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0720058754	G -> A	LOC_Os07g33570.1	intron_variant ; MODIFIER	silent_mutation	Average:33.635; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720058754	5.60E-08	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754	2.63E-08	6.44E-13	mr1486	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754	NA	5.08E-08	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754	NA	3.73E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754	NA	5.72E-06	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754	NA	1.22E-09	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754	1.12E-06	NA	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720058754	7.95E-07	6.80E-08	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251