\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720057906:

Variant ID: vg0720057906 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20057906
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACGTTGACGCCGGGTGGACGAGGAACTAAGTCCCACATCCGGTTGGCGAGAAGAGCATTGTACTCCTCTTCCATAGCAGTGCACCAATGGGGGTCCGCCA[A/G]
GGCCGCACGATAGGTGCGAGGCACCGGCGACAAGGGTGCGGCGTGGAGGTTGAGGCGATCGATCGGTCGTCGTATGCCAGATTTGCCACGCGTGACCATG

Reverse complement sequence

CATGGTCACGCGTGGCAAATCTGGCATACGACGACCGATCGATCGCCTCAACCTCCACGCCGCACCCTTGTCGCCGGTGCCTCGCACCTATCGTGCGGCC[T/C]
TGGCGGACCCCCATTGGTGCACTGCTATGGAAGAGGAGTACAATGCTCTTCTCGCCAACCGGATGTGGGACTTAGTTCCTCGTCCACCCGGCGTCAACGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 15.20% 1.31% 29.94% NA
All Indica  2759 22.30% 25.50% 2.10% 50.09% NA
All Japonica  1512 99.30% 0.20% 0.00% 0.46% NA
Aus  269 96.30% 0.40% 0.74% 2.60% NA
Indica I  595 11.60% 39.80% 1.18% 47.39% NA
Indica II  465 21.90% 22.80% 4.09% 51.18% NA
Indica III  913 23.30% 20.70% 1.64% 54.33% NA
Indica Intermediate  786 29.40% 21.90% 2.16% 46.56% NA
Temperate Japonica  767 99.00% 0.30% 0.00% 0.78% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 64.40% 12.20% 2.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720057906 A -> DEL LOC_Os07g33570.1 N frameshift_variant Average:34.868; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0720057906 A -> G LOC_Os07g33570.1 synonymous_variant ; p.Leu426Leu; LOW synonymous_codon Average:34.868; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720057906 NA 1.24E-09 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057906 NA 7.66E-07 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057906 NA 8.80E-08 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057906 NA 7.98E-09 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057906 1.39E-07 NA mr1721_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057906 5.03E-07 5.21E-10 mr1721_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251