\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720057093:

Variant ID: vg0720057093 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20057093
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTGGACAGCATAGGATATATCTGGCCTGGTGAAAGTGAGATATTGTAATGCACCAGCGAGGCTCCTGTAATCAGTCAGGTCAGCAACTGGGGCACCAT[C/T]
GACAGCTGAGAGCTTGGCATTAGTGTCGACCGGCGTAGAACATGGCTTGCACTCGGACATGCCAGCACGAGCAAGAACATCAAGAATGTACTGTTGCTGG

Reverse complement sequence

CCAGCAACAGTACATTCTTGATGTTCTTGCTCGTGCTGGCATGTCCGAGTGCAAGCCATGTTCTACGCCGGTCGACACTAATGCCAAGCTCTCAGCTGTC[G/A]
ATGGTGCCCCAGTTGCTGACCTGACTGATTACAGGAGCCTCGCTGGTGCATTACAATATCTCACTTTCACCAGGCCAGATATATCCTATGCTGTCCAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 11.70% 2.84% 27.82% NA
All Indica  2759 28.90% 19.80% 4.68% 46.68% NA
All Japonica  1512 99.30% 0.20% 0.00% 0.46% NA
Aus  269 97.40% 0.40% 0.00% 2.23% NA
Indica I  595 12.40% 39.20% 4.03% 44.37% NA
Indica II  465 26.00% 21.50% 6.02% 46.45% NA
Indica III  913 35.90% 8.30% 3.94% 51.81% NA
Indica Intermediate  786 34.70% 17.40% 5.22% 42.62% NA
Temperate Japonica  767 99.00% 0.30% 0.00% 0.78% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 77.80% 2.20% 4.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720057093 C -> DEL LOC_Os07g33570.1 N frameshift_variant Average:36.311; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg0720057093 C -> T LOC_Os07g33570.1 missense_variant ; p.Asp697Asn; MODERATE nonsynonymous_codon ; D697N Average:36.311; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 benign 1.021 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720057093 3.31E-08 NA mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057093 1.54E-08 1.39E-12 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057093 7.73E-06 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057093 3.76E-06 1.54E-08 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057093 NA 1.40E-07 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057093 NA 1.16E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057093 4.57E-06 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057093 1.29E-06 6.34E-12 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720057093 NA 7.95E-08 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251