\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720055978:

Variant ID: vg0720055978 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20055978
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ACATGACGCCGTCGACGAGCTGCGGCATGGAGCATTTGGCCAGGGCCCCCGGGCCGCAGCCGACGCGGAGCCCGACGCCGGCCATGTAGTTGCAGACTTC[T/C]
GTGCGAATCATCTCCTGCATCGTGTAGATGAGATCGGTGTTGAACGGGTATGGGGACGGAGATGTTGCCGGCGGCGGCGGCGGCGAGGGCGGTAGCGAAG

Reverse complement sequence

CTTCGCTACCGCCCTCGCCGCCGCCGCCGCCGGCAACATCTCCGTCCCCATACCCGTTCAACACCGATCTCATCTACACGATGCAGGAGATGATTCGCAC[A/G]
GAAGTCTGCAACTACATGGCCGGCGTCGGGCTCCGCGTCGGCTGCGGCCCGGGGGCCCTGGCCAAATGCTCCATGCCGCAGCTCGTCGACGGCGTCATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 21.30% 0.97% 45.28% NA
All Indica  2759 21.60% 0.90% 1.56% 75.93% NA
All Japonica  1512 35.10% 64.20% 0.00% 0.73% NA
Aus  269 97.40% 0.00% 0.00% 2.60% NA
Indica I  595 10.90% 0.50% 0.67% 87.90% NA
Indica II  465 18.30% 1.70% 0.22% 79.78% NA
Indica III  913 27.70% 0.20% 2.74% 69.33% NA
Indica Intermediate  786 24.70% 1.40% 1.65% 72.26% NA
Temperate Japonica  767 2.50% 96.30% 0.00% 1.17% NA
Tropical Japonica  504 88.30% 11.70% 0.00% 0.00% NA
Japonica Intermediate  241 27.80% 71.40% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 51.10% 15.60% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720055978 T -> DEL N N silent_mutation Average:16.013; most accessible tissue: Callus, score: 56.385 N N N N
vg0720055978 T -> C LOC_Os07g33560.1 downstream_gene_variant ; 1933.0bp to feature; MODIFIER silent_mutation Average:16.013; most accessible tissue: Callus, score: 56.385 N N N N
vg0720055978 T -> C LOC_Os07g33570.1 downstream_gene_variant ; 639.0bp to feature; MODIFIER silent_mutation Average:16.013; most accessible tissue: Callus, score: 56.385 N N N N
vg0720055978 T -> C LOC_Os07g33560-LOC_Os07g33570 intergenic_region ; MODIFIER silent_mutation Average:16.013; most accessible tissue: Callus, score: 56.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720055978 NA 6.23E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 1.31E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 1.02E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 1.28E-06 NA mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 1.82E-06 3.68E-08 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 5.53E-06 7.51E-07 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 9.16E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 1.68E-10 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 8.19E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 3.95E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 6.51E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 1.11E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 9.19E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 2.39E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720055978 NA 3.94E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251