\
| Variant ID: vg0720047684 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20047684 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 209. )
AGTTCAGGTGGAAATTGTGCTGCAAAGATGAAGGTTACAGGAAAGATCCTGTTCCGATGCCTCTTGAACTCCCAATTGAACTTGAGACCAGAAGCTCCCC[C/T]
TGGATATGCTTAAAATGATCCACCTGTTTTTAGTTTATGCTTTCACTAGTTGGTTGAAGAGTTGGAAATGTTGCAGTTGTGAAGATCTTGGTAAAGTTGT
ACAACTTTACCAAGATCTTCACAACTGCAACATTTCCAACTCTTCAACCAACTAGTGAAAGCATAAACTAAAAACAGGTGGATCATTTTAAGCATATCCA[G/A]
GGGGAGCTTCTGGTCTCAAGTTCAATTGGGAGTTCAAGAGGCATCGGAACAGGATCTTTCCTGTAACCTTCATCTTTGCAGCACAATTTCCACCTGAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.80% | 15.60% | 1.23% | 41.43% | NA |
| All Indica | 2759 | 19.20% | 9.20% | 2.03% | 69.55% | NA |
| All Japonica | 1512 | 75.60% | 23.80% | 0.00% | 0.60% | NA |
| Aus | 269 | 97.40% | 0.00% | 0.00% | 2.60% | NA |
| Indica I | 595 | 2.00% | 10.10% | 0.84% | 87.06% | NA |
| Indica II | 465 | 7.50% | 15.50% | 2.58% | 74.41% | NA |
| Indica III | 913 | 35.50% | 3.00% | 2.74% | 58.82% | NA |
| Indica Intermediate | 786 | 20.20% | 12.10% | 1.78% | 65.90% | NA |
| Temperate Japonica | 767 | 96.70% | 2.30% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 24.50% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 33.30% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720047684 | C -> DEL | LOC_Os07g33550.1 | N | frameshift_variant | Average:17.295; most accessible tissue: Callus, score: 74.478 | N | N | N | N |
| vg0720047684 | C -> T | LOC_Os07g33550.1 | synonymous_variant ; p.Pro474Pro; LOW | synonymous_codon | Average:17.295; most accessible tissue: Callus, score: 74.478 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720047684 | NA | 4.78E-32 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 6.98E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 5.58E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 6.88E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 1.94E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 1.58E-09 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 3.39E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 5.85E-16 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 1.24E-06 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 1.05E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | 2.08E-06 | 3.79E-14 | mr1364_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 6.54E-11 | mr1364_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 1.50E-24 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 6.64E-06 | mr1460_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 2.93E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720047684 | NA | 1.04E-18 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |