\
| Variant ID: vg0720034658 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20034658 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 107. )
TGTAAAAAAATGTGGAATGGCGCATAATATTATAATGCGATTATAAAAATAGATGCCTAAGAGGTTCCTTTTCTTTTCTTTTTACTAAAAGAGGATCTAC[G/A]
GTATGCCACTAGGTAAACTAGATGAAACCTGACGCGTTGTTGCGTGAGTTTTATAGGATAATAGTACAAATAACATGCAGATAGCTACACGGTATAACTT
AAGTTATACCGTGTAGCTATCTGCATGTTATTTGTACTATTATCCTATAAAACTCACGCAACAACGCGTCAGGTTTCATCTAGTTTACCTAGTGGCATAC[C/T]
GTAGATCCTCTTTTAGTAAAAAGAAAAGAAAAGGAACCTCTTAGGCATCTATTTTTATAATCGCATTATAATATTATGCGCCATTCCACATTTTTTTACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.60% | 15.50% | 0.40% | 42.47% | NA |
| All Indica | 2759 | 18.90% | 9.20% | 0.65% | 71.29% | NA |
| All Japonica | 1512 | 75.50% | 23.80% | 0.07% | 0.60% | NA |
| Aus | 269 | 97.40% | 0.00% | 0.00% | 2.60% | NA |
| Indica I | 595 | 2.50% | 9.70% | 0.50% | 87.23% | NA |
| Indica II | 465 | 6.50% | 15.50% | 1.29% | 76.77% | NA |
| Indica III | 913 | 35.20% | 3.00% | 0.00% | 61.88% | NA |
| Indica Intermediate | 786 | 19.70% | 12.20% | 1.15% | 66.92% | NA |
| Temperate Japonica | 767 | 96.60% | 2.30% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 43.70% | 56.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 33.30% | 0.00% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720034658 | G -> DEL | N | N | silent_mutation | Average:10.384; most accessible tissue: Callus, score: 46.0 | N | N | N | N |
| vg0720034658 | G -> A | LOC_Os07g33530.1 | upstream_gene_variant ; 1924.0bp to feature; MODIFIER | silent_mutation | Average:10.384; most accessible tissue: Callus, score: 46.0 | N | N | N | N |
| vg0720034658 | G -> A | LOC_Os07g33520.1 | downstream_gene_variant ; 2251.0bp to feature; MODIFIER | silent_mutation | Average:10.384; most accessible tissue: Callus, score: 46.0 | N | N | N | N |
| vg0720034658 | G -> A | LOC_Os07g33520-LOC_Os07g33530 | intergenic_region ; MODIFIER | silent_mutation | Average:10.384; most accessible tissue: Callus, score: 46.0 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720034658 | NA | 1.86E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | NA | 5.14E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | NA | 1.59E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | NA | 2.08E-09 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | NA | 4.00E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | NA | 8.37E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | 3.33E-06 | 4.35E-10 | mr1364_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | NA | 5.86E-11 | mr1364_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | NA | 5.32E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720034658 | NA | 1.48E-10 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |