\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720034658:

Variant ID: vg0720034658 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20034658
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAAAAAAATGTGGAATGGCGCATAATATTATAATGCGATTATAAAAATAGATGCCTAAGAGGTTCCTTTTCTTTTCTTTTTACTAAAAGAGGATCTAC[G/A]
GTATGCCACTAGGTAAACTAGATGAAACCTGACGCGTTGTTGCGTGAGTTTTATAGGATAATAGTACAAATAACATGCAGATAGCTACACGGTATAACTT

Reverse complement sequence

AAGTTATACCGTGTAGCTATCTGCATGTTATTTGTACTATTATCCTATAAAACTCACGCAACAACGCGTCAGGTTTCATCTAGTTTACCTAGTGGCATAC[C/T]
GTAGATCCTCTTTTAGTAAAAAGAAAAGAAAAGGAACCTCTTAGGCATCTATTTTTATAATCGCATTATAATATTATGCGCCATTCCACATTTTTTTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.60% 15.50% 0.40% 42.47% NA
All Indica  2759 18.90% 9.20% 0.65% 71.29% NA
All Japonica  1512 75.50% 23.80% 0.07% 0.60% NA
Aus  269 97.40% 0.00% 0.00% 2.60% NA
Indica I  595 2.50% 9.70% 0.50% 87.23% NA
Indica II  465 6.50% 15.50% 1.29% 76.77% NA
Indica III  913 35.20% 3.00% 0.00% 61.88% NA
Indica Intermediate  786 19.70% 12.20% 1.15% 66.92% NA
Temperate Japonica  767 96.60% 2.30% 0.13% 0.91% NA
Tropical Japonica  504 43.70% 56.30% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.10% 0.00% 0.83% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 40.00% 33.30% 0.00% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720034658 G -> DEL N N silent_mutation Average:10.384; most accessible tissue: Callus, score: 46.0 N N N N
vg0720034658 G -> A LOC_Os07g33530.1 upstream_gene_variant ; 1924.0bp to feature; MODIFIER silent_mutation Average:10.384; most accessible tissue: Callus, score: 46.0 N N N N
vg0720034658 G -> A LOC_Os07g33520.1 downstream_gene_variant ; 2251.0bp to feature; MODIFIER silent_mutation Average:10.384; most accessible tissue: Callus, score: 46.0 N N N N
vg0720034658 G -> A LOC_Os07g33520-LOC_Os07g33530 intergenic_region ; MODIFIER silent_mutation Average:10.384; most accessible tissue: Callus, score: 46.0 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720034658 NA 1.86E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 NA 5.14E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 NA 1.59E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 NA 2.08E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 NA 4.00E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 NA 8.37E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 3.33E-06 4.35E-10 mr1364_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 NA 5.86E-11 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 NA 5.32E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658 NA 1.48E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251