\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720025560:

Variant ID: vg0720025560 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20025560
Reference Allele: GAlternative Allele: T,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CATAGCATGTTGAGAACGCGGTTTTGGGTATGTCCCCGGTTCTAATTTTCAATTGGTGGTATCCTGACCGAAGGTCAATCTTAGAGAACACCTTAGCTCC[G/T,A]
TTGAGTTGATCAAAAAGATCATCAATCCGTGGTAGTGGATACTTGTTTTTAATAGTTACTTCGTTCAGTGATCGGTAGTCTACACACATTCTCATGCTAC

Reverse complement sequence

GTAGCATGAGAATGTGTGTAGACTACCGATCACTGAACGAAGTAACTATTAAAAACAAGTATCCACTACCACGGATTGATGATCTTTTTGATCAACTCAA[C/A,T]
GGAGCTAAGGTGTTCTCTAAGATTGACCTTCGGTCAGGATACCACCAATTGAAAATTAGAACCGGGGACATACCCAAAACCGCGTTCTCAACATGCTATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 20.80% 9.75% 5.97% A: 0.51%
All Indica  2759 92.80% 1.00% 4.97% 0.40% A: 0.87%
All Japonica  1512 7.90% 62.00% 12.70% 17.39% NA
Aus  269 79.90% 0.40% 19.70% 0.00% NA
Indica I  595 93.30% 0.70% 5.88% 0.17% NA
Indica II  465 88.60% 1.70% 7.74% 1.08% A: 0.86%
Indica III  913 96.30% 0.20% 1.64% 0.00% A: 1.86%
Indica Intermediate  786 90.80% 1.70% 6.49% 0.64% A: 0.38%
Temperate Japonica  767 1.30% 94.00% 0.52% 4.17% NA
Tropical Japonica  504 19.80% 12.10% 33.73% 34.33% NA
Japonica Intermediate  241 3.70% 64.70% 7.47% 24.07% NA
VI/Aromatic  96 32.30% 2.10% 62.50% 3.12% NA
Intermediate  90 54.40% 18.90% 21.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720025560 G -> DEL LOC_Os07g33500.1 N frameshift_variant Average:31.856; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0720025560 G -> A LOC_Os07g33500.1 synonymous_variant ; p.Asn623Asn; LOW synonymous_codon Average:31.856; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0720025560 G -> T LOC_Os07g33500.1 missense_variant ; p.Asn623Lys; MODERATE nonsynonymous_codon Average:31.856; most accessible tissue: Minghui63 young leaf, score: 56.213 possibly damaging -1.525 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720025560 NA 4.98E-37 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0720025560 NA 1.09E-54 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0720025560 NA 7.92E-41 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 7.99E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 6.14E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.52E-89 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 5.93E-15 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 3.16E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 3.28E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 2.46E-06 4.70E-26 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.12E-10 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.54E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 1.37E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.61E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 4.59E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 4.77E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 1.68E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.89E-52 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 8.77E-51 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 1.87E-52 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 3.77E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 5.18E-101 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.00E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 3.85E-06 4.96E-27 mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 4.09E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 5.63E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 1.11E-28 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.15E-39 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.45E-43 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 2.29E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720025560 NA 4.05E-41 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251