\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720024015:

Variant ID: vg0720024015 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20024015
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTGGTCATGTATAACTCGGCTAGCTTAGCACTGCTATAATTTGTCTTAACGGGAATGAATCTCGCCGTCTTGGTGAGTCGATCCACGATCACCCAAAT[A/G]
GAATCATATCCTGTTGCGGTTTTGGGCAATCCAACAATAAAATCCATACCTATCTCATCCCATTTCCATTCGGGAATCCTAAGGGGTTGCAGCAAGCCTG

Reverse complement sequence

CAGGCTTGCTGCAACCCCTTAGGATTCCCGAATGGAAATGGGATGAGATAGGTATGGATTTTATTGTTGGATTGCCCAAAACCGCAACAGGATATGATTC[T/C]
ATTTGGGTGATCGTGGATCGACTCACCAAGACGGCGAGATTCATTCCCGTTAAGACAAATTATAGCAGTGCTAAGCTAGCCGAGTTATACATGACCAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 0.10% 30.36% 28.40% NA
All Indica  2759 15.20% 0.30% 44.84% 39.76% NA
All Japonica  1512 73.80% 0.00% 11.84% 14.35% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 11.30% 0.20% 17.48% 71.09% NA
Indica II  465 24.30% 0.60% 34.84% 40.22% NA
Indica III  913 7.70% 0.10% 72.29% 19.93% NA
Indica Intermediate  786 21.40% 0.30% 39.57% 38.80% NA
Temperate Japonica  767 96.00% 0.00% 0.91% 3.13% NA
Tropical Japonica  504 37.70% 0.00% 30.95% 31.35% NA
Japonica Intermediate  241 78.80% 0.00% 6.64% 14.52% NA
VI/Aromatic  96 95.80% 0.00% 2.08% 2.08% NA
Intermediate  90 54.40% 0.00% 16.67% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720024015 A -> DEL LOC_Os07g33500.1 N frameshift_variant Average:25.555; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0720024015 A -> G LOC_Os07g33500.1 synonymous_variant ; p.Ser1115Ser; LOW synonymous_codon Average:25.555; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720024015 NA 3.38E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 1.04E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 4.96E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 7.29E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 1.80E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 1.02E-15 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 2.77E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 4.45E-16 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 9.60E-09 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 2.48E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 4.89E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 6.58E-07 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 2.75E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 6.17E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 1.91E-18 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 3.70E-19 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 2.05E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 5.35E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 7.30E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 7.14E-20 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 1.15E-09 mr1733_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720024015 NA 7.03E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251