| Variant ID: vg0720024015 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20024015 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCCTGGTCATGTATAACTCGGCTAGCTTAGCACTGCTATAATTTGTCTTAACGGGAATGAATCTCGCCGTCTTGGTGAGTCGATCCACGATCACCCAAAT[A/G]
GAATCATATCCTGTTGCGGTTTTGGGCAATCCAACAATAAAATCCATACCTATCTCATCCCATTTCCATTCGGGAATCCTAAGGGGTTGCAGCAAGCCTG
CAGGCTTGCTGCAACCCCTTAGGATTCCCGAATGGAAATGGGATGAGATAGGTATGGATTTTATTGTTGGATTGCCCAAAACCGCAACAGGATATGATTC[T/C]
ATTTGGGTGATCGTGGATCGACTCACCAAGACGGCGAGATTCATTCCCGTTAAGACAAATTATAGCAGTGCTAAGCTAGCCGAGTTATACATGACCAGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.10% | 0.10% | 30.36% | 28.40% | NA |
| All Indica | 2759 | 15.20% | 0.30% | 44.84% | 39.76% | NA |
| All Japonica | 1512 | 73.80% | 0.00% | 11.84% | 14.35% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 11.30% | 0.20% | 17.48% | 71.09% | NA |
| Indica II | 465 | 24.30% | 0.60% | 34.84% | 40.22% | NA |
| Indica III | 913 | 7.70% | 0.10% | 72.29% | 19.93% | NA |
| Indica Intermediate | 786 | 21.40% | 0.30% | 39.57% | 38.80% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.91% | 3.13% | NA |
| Tropical Japonica | 504 | 37.70% | 0.00% | 30.95% | 31.35% | NA |
| Japonica Intermediate | 241 | 78.80% | 0.00% | 6.64% | 14.52% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 54.40% | 0.00% | 16.67% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720024015 | A -> DEL | LOC_Os07g33500.1 | N | frameshift_variant | Average:25.555; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0720024015 | A -> G | LOC_Os07g33500.1 | synonymous_variant ; p.Ser1115Ser; LOW | synonymous_codon | Average:25.555; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720024015 | NA | 3.38E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 1.04E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 4.96E-08 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 7.29E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 1.80E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 1.02E-15 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 2.77E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 4.45E-16 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 9.60E-09 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720024015 | NA | 2.48E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/