\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720001553:

Variant ID: vg0720001553 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20001553
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTGTCCAAGTACACTTGATGCCCCGAAACTGGGGATTCACCTTATAGAGCGCGTCGTGTGGGCTTATGATTAGGGTTTAAAATTTTGGTTCGAAATTT[C/T]
GGTAATTTTCGCCCCACCCCCCCCACCAGCATGCTCAAATCTCATTCGAAATTTTCGGGTTTTTTTGCATTTTTTGCGAATTTGGTCCAATTGTATTCAA

Reverse complement sequence

TTGAATACAATTGGACCAAATTCGCAAAAAATGCAAAAAAACCCGAAAATTTCGAATGAGATTTGAGCATGCTGGTGGGGGGGGTGGGGCGAAAATTACC[G/A]
AAATTTCGAACCAAAATTTTAAACCCTAATCATAAGCCCACACGACGCGCTCTATAAGGTGAATCCCCAGTTTCGGGGCATCAAGTGTACTTGGACACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 6.00% 0.00% 3.43% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 73.10% 16.30% 0.00% 10.58% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 32.90% 35.90% 0.00% 31.15% NA
Japonica Intermediate  241 77.60% 21.20% 0.00% 1.24% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720001553 C -> DEL N N silent_mutation Average:31.782; most accessible tissue: Callus, score: 67.903 N N N N
vg0720001553 C -> T LOC_Os07g33470.1 upstream_gene_variant ; 1926.0bp to feature; MODIFIER silent_mutation Average:31.782; most accessible tissue: Callus, score: 67.903 N N N N
vg0720001553 C -> T LOC_Os07g33460.1 downstream_gene_variant ; 1240.0bp to feature; MODIFIER silent_mutation Average:31.782; most accessible tissue: Callus, score: 67.903 N N N N
vg0720001553 C -> T LOC_Os07g33460-LOC_Os07g33470 intergenic_region ; MODIFIER silent_mutation Average:31.782; most accessible tissue: Callus, score: 67.903 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720001553 NA 1.42E-11 mr1248 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001553 NA 1.10E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001553 NA 9.23E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001553 NA 2.84E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001553 NA 1.93E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001553 NA 4.96E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001553 NA 3.80E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001553 NA 1.25E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001553 NA 4.45E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251