\
| Variant ID: vg0720001553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20001553 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGTGTCCAAGTACACTTGATGCCCCGAAACTGGGGATTCACCTTATAGAGCGCGTCGTGTGGGCTTATGATTAGGGTTTAAAATTTTGGTTCGAAATTT[C/T]
GGTAATTTTCGCCCCACCCCCCCCACCAGCATGCTCAAATCTCATTCGAAATTTTCGGGTTTTTTTGCATTTTTTGCGAATTTGGTCCAATTGTATTCAA
TTGAATACAATTGGACCAAATTCGCAAAAAATGCAAAAAAACCCGAAAATTTCGAATGAGATTTGAGCATGCTGGTGGGGGGGGTGGGGCGAAAATTACC[G/A]
AAATTTCGAACCAAAATTTTAAACCCTAATCATAAGCCCACACGACGCGCTCTATAAGGTGAATCCCCAGTTTCGGGGCATCAAGTGTACTTGGACACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 6.00% | 0.00% | 3.43% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 73.10% | 16.30% | 0.00% | 10.58% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.90% | 35.90% | 0.00% | 31.15% | NA |
| Japonica Intermediate | 241 | 77.60% | 21.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720001553 | C -> DEL | N | N | silent_mutation | Average:31.782; most accessible tissue: Callus, score: 67.903 | N | N | N | N |
| vg0720001553 | C -> T | LOC_Os07g33470.1 | upstream_gene_variant ; 1926.0bp to feature; MODIFIER | silent_mutation | Average:31.782; most accessible tissue: Callus, score: 67.903 | N | N | N | N |
| vg0720001553 | C -> T | LOC_Os07g33460.1 | downstream_gene_variant ; 1240.0bp to feature; MODIFIER | silent_mutation | Average:31.782; most accessible tissue: Callus, score: 67.903 | N | N | N | N |
| vg0720001553 | C -> T | LOC_Os07g33460-LOC_Os07g33470 | intergenic_region ; MODIFIER | silent_mutation | Average:31.782; most accessible tissue: Callus, score: 67.903 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720001553 | NA | 1.42E-11 | mr1248 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001553 | NA | 1.10E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001553 | NA | 9.23E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001553 | NA | 2.84E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001553 | NA | 1.93E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001553 | NA | 4.96E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001553 | NA | 3.80E-09 | mr1364_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001553 | NA | 1.25E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720001553 | NA | 4.45E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |