Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719981901:

Variant ID: vg0719981901 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19981901
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.34, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAGTGTTCGATGGTAACTATAACCACAACAAAGAACTATAGTCCACGGCGATAATGTGAACATGTTTTCTAAGCAATAACTTACCAAGTGTGACACGA[T/C]
ACACAAAATGCTACTCCAAGTGAGGTAATGTTTGATTAGAGAATGAGCGTATGATATATAGACCCACGGAGTAAAGAAAGTGTGGCCTCGCCGCATTAGA

Reverse complement sequence

TCTAATGCGGCGAGGCCACACTTTCTTTACTCCGTGGGTCTATATATCATACGCTCATTCTCTAATCAAACATTACCTCACTTGGAGTAGCATTTTGTGT[A/G]
TCGTGTCACACTTGGTAAGTTATTGCTTAGAAAACATGTTCACATTATCGCCGTGGACTATAGTTCTTTGTTGTGGTTATAGTTACCATCGAACACTTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.50%	11.60%	1.50%	65.45%	NA
All Indica	2759	2.30%	7.80%	0.80%	89.13%	NA
All Japonica	1512	61.70%	3.60%	3.04%	31.61%	NA
Aus	269	0.00%	97.40%	0.00%	2.60%	NA
Indica I	595	1.20%	10.60%	0.67%	87.56%	NA
Indica II	465	2.80%	1.70%	0.86%	94.62%	NA
Indica III	913	2.20%	2.50%	0.55%	94.74%	NA
Indica Intermediate	786	3.10%	15.30%	1.15%	80.53%	NA
Temperate Japonica	767	94.10%	2.30%	0.52%	3.00%	NA
Tropical Japonica	504	11.50%	2.80%	6.75%	78.97%	NA
Japonica Intermediate	241	63.50%	9.50%	3.32%	23.65%	NA
VI/Aromatic	96	1.00%	3.10%	0.00%	95.83%	NA
Intermediate	90	18.90%	14.40%	3.33%	63.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719981901	T -> DEL	N	N	silent_mutation	Average:12.216; most accessible tissue: Callus, score: 77.354	N	N	N	N
vg0719981901	T -> C	LOC_Os07g33420.1	upstream_gene_variant ; 538.0bp to feature; MODIFIER	silent_mutation	Average:12.216; most accessible tissue: Callus, score: 77.354	N	N	N	N
vg0719981901	T -> C	LOC_Os07g33440.1	upstream_gene_variant ; 3811.0bp to feature; MODIFIER	silent_mutation	Average:12.216; most accessible tissue: Callus, score: 77.354	N	N	N	N
vg0719981901	T -> C	LOC_Os07g33420.3	upstream_gene_variant ; 538.0bp to feature; MODIFIER	silent_mutation	Average:12.216; most accessible tissue: Callus, score: 77.354	N	N	N	N
vg0719981901	T -> C	LOC_Os07g33420.2	upstream_gene_variant ; 537.0bp to feature; MODIFIER	silent_mutation	Average:12.216; most accessible tissue: Callus, score: 77.354	N	N	N	N
vg0719981901	T -> C	LOC_Os07g33420.4	upstream_gene_variant ; 537.0bp to feature; MODIFIER	silent_mutation	Average:12.216; most accessible tissue: Callus, score: 77.354	N	N	N	N
vg0719981901	T -> C	LOC_Os07g33420-LOC_Os07g33440	intergenic_region ; MODIFIER	silent_mutation	Average:12.216; most accessible tissue: Callus, score: 77.354	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719981901	NA	8.35E-07	mr1045	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	3.69E-06	mr1049	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	2.04E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	2.07E-07	2.07E-07	mr1162	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	1.46E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	7.38E-10	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	2.63E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	8.80E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	1.14E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	9.04E-06	9.04E-06	mr1054_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	4.97E-07	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	8.40E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	2.30E-07	2.30E-07	mr1259_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	3.18E-07	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	2.54E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	8.18E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	5.86E-06	5.86E-06	mr1356_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	2.45E-10	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	4.80E-06	4.80E-06	mr1365_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	4.77E-07	mr1377_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	5.39E-06	5.39E-06	mr1384_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	8.90E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	3.34E-06	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	6.08E-12	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	6.68E-06	6.68E-06	mr1573_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	6.35E-09	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	6.76E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	6.86E-06	6.85E-06	mr1640_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	6.13E-06	6.13E-06	mr1704_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	8.82E-06	mr1719_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	7.72E-06	mr1741_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	7.39E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	2.60E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	1.76E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	NA	1.45E-07	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	3.26E-06	3.26E-06	mr1939_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901	3.21E-06	3.21E-06	mr1941_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251