\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719981901:

Variant ID: vg0719981901 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19981901
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.34, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGTGTTCGATGGTAACTATAACCACAACAAAGAACTATAGTCCACGGCGATAATGTGAACATGTTTTCTAAGCAATAACTTACCAAGTGTGACACGA[T/C]
ACACAAAATGCTACTCCAAGTGAGGTAATGTTTGATTAGAGAATGAGCGTATGATATATAGACCCACGGAGTAAAGAAAGTGTGGCCTCGCCGCATTAGA

Reverse complement sequence

TCTAATGCGGCGAGGCCACACTTTCTTTACTCCGTGGGTCTATATATCATACGCTCATTCTCTAATCAAACATTACCTCACTTGGAGTAGCATTTTGTGT[A/G]
TCGTGTCACACTTGGTAAGTTATTGCTTAGAAAACATGTTCACATTATCGCCGTGGACTATAGTTCTTTGTTGTGGTTATAGTTACCATCGAACACTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.50% 11.60% 1.50% 65.45% NA
All Indica  2759 2.30% 7.80% 0.80% 89.13% NA
All Japonica  1512 61.70% 3.60% 3.04% 31.61% NA
Aus  269 0.00% 97.40% 0.00% 2.60% NA
Indica I  595 1.20% 10.60% 0.67% 87.56% NA
Indica II  465 2.80% 1.70% 0.86% 94.62% NA
Indica III  913 2.20% 2.50% 0.55% 94.74% NA
Indica Intermediate  786 3.10% 15.30% 1.15% 80.53% NA
Temperate Japonica  767 94.10% 2.30% 0.52% 3.00% NA
Tropical Japonica  504 11.50% 2.80% 6.75% 78.97% NA
Japonica Intermediate  241 63.50% 9.50% 3.32% 23.65% NA
VI/Aromatic  96 1.00% 3.10% 0.00% 95.83% NA
Intermediate  90 18.90% 14.40% 3.33% 63.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719981901 T -> DEL N N silent_mutation Average:12.216; most accessible tissue: Callus, score: 77.354 N N N N
vg0719981901 T -> C LOC_Os07g33420.1 upstream_gene_variant ; 538.0bp to feature; MODIFIER silent_mutation Average:12.216; most accessible tissue: Callus, score: 77.354 N N N N
vg0719981901 T -> C LOC_Os07g33440.1 upstream_gene_variant ; 3811.0bp to feature; MODIFIER silent_mutation Average:12.216; most accessible tissue: Callus, score: 77.354 N N N N
vg0719981901 T -> C LOC_Os07g33420.3 upstream_gene_variant ; 538.0bp to feature; MODIFIER silent_mutation Average:12.216; most accessible tissue: Callus, score: 77.354 N N N N
vg0719981901 T -> C LOC_Os07g33420.2 upstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:12.216; most accessible tissue: Callus, score: 77.354 N N N N
vg0719981901 T -> C LOC_Os07g33420.4 upstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:12.216; most accessible tissue: Callus, score: 77.354 N N N N
vg0719981901 T -> C LOC_Os07g33420-LOC_Os07g33440 intergenic_region ; MODIFIER silent_mutation Average:12.216; most accessible tissue: Callus, score: 77.354 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719981901 NA 8.35E-07 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 3.69E-06 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 2.04E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 2.07E-07 2.07E-07 mr1162 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 1.46E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 7.38E-10 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 2.63E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 8.80E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 1.14E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 9.04E-06 9.04E-06 mr1054_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 4.97E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 8.40E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 2.30E-07 2.30E-07 mr1259_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 3.18E-07 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 2.54E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 8.18E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 5.86E-06 5.86E-06 mr1356_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 2.45E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 4.80E-06 4.80E-06 mr1365_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 4.77E-07 mr1377_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 5.39E-06 5.39E-06 mr1384_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 8.90E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 3.34E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 6.08E-12 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 6.68E-06 6.68E-06 mr1573_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 6.35E-09 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 6.76E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 6.86E-06 6.85E-06 mr1640_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 6.13E-06 6.13E-06 mr1704_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 8.82E-06 mr1719_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 7.72E-06 mr1741_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 7.39E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 2.60E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 1.76E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 NA 1.45E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 3.26E-06 3.26E-06 mr1939_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719981901 3.21E-06 3.21E-06 mr1941_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251