\
| Variant ID: vg0719969117 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19969117 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGCATATGGTTTGTGTATGATGACTAAGCATTAACTATTACAAACTTAAAAAATAGAGAAACATGTCTACCATAAACGACTAATTAGATGACTCTAACC[G/A]
TATTATTATTAAACTCATCCTTAGGGTAGTCTCGGTTAACTAATCGTAAGTACGTTTCCCAAACTTATAAACGGTATGAATTTTGCAAATAGTTTCTATA
TATAGAAACTATTTGCAAAATTCATACCGTTTATAAGTTTGGGAAACGTACTTACGATTAGTTAACCGAGACTACCCTAAGGATGAGTTTAATAATAATA[C/T]
GGTTAGAGTCATCTAATTAGTCGTTTATGGTAGACATGTTTCTCTATTTTTTAAGTTTGTAATAGTTAATGCTTAGTCATCATACACAAACCATATGCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 72.80% | 27.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.70% | 67.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719969117 | G -> A | LOC_Os07g33410.1 | upstream_gene_variant ; 1408.0bp to feature; MODIFIER | silent_mutation | Average:45.804; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0719969117 | G -> A | LOC_Os07g33390-LOC_Os07g33410 | intergenic_region ; MODIFIER | silent_mutation | Average:45.804; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719969117 | NA | 2.92E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | 1.14E-06 | NA | mr1422 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 7.08E-08 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 3.05E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 3.51E-09 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 5.92E-13 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 7.51E-07 | mr1578 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 1.60E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 6.88E-31 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 4.37E-21 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 3.64E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | 1.48E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | 3.48E-06 | NA | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 4.52E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 1.88E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 1.71E-32 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 3.12E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | 7.24E-08 | 4.06E-21 | mr1715_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 1.76E-07 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 2.92E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 4.39E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719969117 | NA | 1.72E-10 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |