\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719952632:

Variant ID: vg0719952632 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19952632
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGTCGCGAATCCATCGTCGCCGCTGGAGGTCGCGTGCCACGCCACCGGATCCATCTCTCTCCTCTCTCTCTCTCTCTCTCTCGTCGCGGGGTCGTCGCC[A/G]
GAGGCCGTGTGCCGCGCCGCCACCCCTCTTCCTCCGCTCGTCGCCGTCGCGGGGTCGTCGCCGAGTCATCGCTGTTGCGGGGTCGTCGCCGAGTCATCGC

Reverse complement sequence

GCGATGACTCGGCGACGACCCCGCAACAGCGATGACTCGGCGACGACCCCGCGACGGCGACGAGCGGAGGAAGAGGGGTGGCGGCGCGGCACACGGCCTC[T/C]
GGCGACGACCCCGCGACGAGAGAGAGAGAGAGAGAGAGGAGAGAGATGGATCCGGTGGCGTGGCACGCGACCTCCAGCGGCGACGATGGATTCGCGACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.10% 0.38% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 47.30% 51.50% 1.19% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 43.50% 54.10% 2.35% 0.00% NA
Tropical Japonica  504 57.30% 42.70% 0.00% 0.00% NA
Japonica Intermediate  241 38.20% 61.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719952632 A -> G LOC_Os07g33370.1 upstream_gene_variant ; 1577.0bp to feature; MODIFIER silent_mutation Average:66.578; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N
vg0719952632 A -> G LOC_Os07g33380.1 upstream_gene_variant ; 4601.0bp to feature; MODIFIER silent_mutation Average:66.578; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N
vg0719952632 A -> G LOC_Os07g33370-LOC_Os07g33380 intergenic_region ; MODIFIER silent_mutation Average:66.578; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719952632 7.87E-06 NA Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719952632 NA 1.08E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 6.47E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 9.69E-08 mr1173_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 2.47E-06 mr1187_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 3.64E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 1.01E-07 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 7.35E-06 7.35E-06 mr1452_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 4.28E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 5.35E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 3.98E-06 7.92E-12 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 6.10E-06 6.37E-13 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 2.39E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 3.86E-08 4.55E-14 mr1821_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 2.25E-06 mr1821_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719952632 NA 3.70E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251