\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719933733:

Variant ID: vg0719933733 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19933733
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAAGTGTGCAATGTGCAACATATCTAGGGGTGAAAATGGTCATTTCGTAAAAATCCTCTCTCTAGAACAAACAAAAATCATAAAATATTGCATGTGGT[A/G]
TCCTTCAATAAAAAACTAAAATTTTAGGGCGTTCATGGGCAAAGCCACATTCTTGCGATGTCCTCTAGCAAAGATCAAGTTATTTAGTGTCTTGTAGAAA

Reverse complement sequence

TTTCTACAAGACACTAAATAACTTGATCTTTGCTAGAGGACATCGCAAGAATGTGGCTTTGCCCATGAACGCCCTAAAATTTTAGTTTTTTATTGAAGGA[T/C]
ACCACATGCAATATTTTATGATTTTTGTTTGTTCTAGAGAGAGGATTTTTACGAAATGACCATTTTCACCCCTAGATATGTTGCACATTGCACACTTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 11.50% 0.53% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 64.00% 34.50% 1.59% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 48.90% 49.00% 2.09% 0.00% NA
Tropical Japonica  504 91.50% 8.30% 0.20% 0.00% NA
Japonica Intermediate  241 54.40% 42.70% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719933733 A -> G LOC_Os07g33340.1 upstream_gene_variant ; 1739.0bp to feature; MODIFIER silent_mutation Average:46.074; most accessible tissue: Callus, score: 72.773 N N N N
vg0719933733 A -> G LOC_Os07g33350.1 upstream_gene_variant ; 1760.0bp to feature; MODIFIER silent_mutation Average:46.074; most accessible tissue: Callus, score: 72.773 N N N N
vg0719933733 A -> G LOC_Os07g33360.1 upstream_gene_variant ; 4710.0bp to feature; MODIFIER silent_mutation Average:46.074; most accessible tissue: Callus, score: 72.773 N N N N
vg0719933733 A -> G LOC_Os07g33350.2 upstream_gene_variant ; 1760.0bp to feature; MODIFIER silent_mutation Average:46.074; most accessible tissue: Callus, score: 72.773 N N N N
vg0719933733 A -> G LOC_Os07g33340-LOC_Os07g33350 intergenic_region ; MODIFIER silent_mutation Average:46.074; most accessible tissue: Callus, score: 72.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719933733 3.20E-06 1.26E-13 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733 NA 3.35E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733 NA 1.90E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733 5.22E-11 3.34E-17 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733 1.39E-07 1.18E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733 NA 4.69E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733 NA 6.86E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733 NA 4.26E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733 NA 6.02E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733 NA 6.29E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733 NA 4.82E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733 4.23E-06 9.56E-10 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733 2.30E-06 NA mr1807_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733 2.34E-07 2.33E-11 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251