\
| Variant ID: vg0719933733 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19933733 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 268. )
AGAAAGTGTGCAATGTGCAACATATCTAGGGGTGAAAATGGTCATTTCGTAAAAATCCTCTCTCTAGAACAAACAAAAATCATAAAATATTGCATGTGGT[A/G]
TCCTTCAATAAAAAACTAAAATTTTAGGGCGTTCATGGGCAAAGCCACATTCTTGCGATGTCCTCTAGCAAAGATCAAGTTATTTAGTGTCTTGTAGAAA
TTTCTACAAGACACTAAATAACTTGATCTTTGCTAGAGGACATCGCAAGAATGTGGCTTTGCCCATGAACGCCCTAAAATTTTAGTTTTTTATTGAAGGA[T/C]
ACCACATGCAATATTTTATGATTTTTGTTTGTTCTAGAGAGAGGATTTTTACGAAATGACCATTTTCACCCCTAGATATGTTGCACATTGCACACTTTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 11.50% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 64.00% | 34.50% | 1.59% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 48.90% | 49.00% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 91.50% | 8.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 54.40% | 42.70% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719933733 | A -> G | LOC_Os07g33340.1 | upstream_gene_variant ; 1739.0bp to feature; MODIFIER | silent_mutation | Average:46.074; most accessible tissue: Callus, score: 72.773 | N | N | N | N |
| vg0719933733 | A -> G | LOC_Os07g33350.1 | upstream_gene_variant ; 1760.0bp to feature; MODIFIER | silent_mutation | Average:46.074; most accessible tissue: Callus, score: 72.773 | N | N | N | N |
| vg0719933733 | A -> G | LOC_Os07g33360.1 | upstream_gene_variant ; 4710.0bp to feature; MODIFIER | silent_mutation | Average:46.074; most accessible tissue: Callus, score: 72.773 | N | N | N | N |
| vg0719933733 | A -> G | LOC_Os07g33350.2 | upstream_gene_variant ; 1760.0bp to feature; MODIFIER | silent_mutation | Average:46.074; most accessible tissue: Callus, score: 72.773 | N | N | N | N |
| vg0719933733 | A -> G | LOC_Os07g33340-LOC_Os07g33350 | intergenic_region ; MODIFIER | silent_mutation | Average:46.074; most accessible tissue: Callus, score: 72.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719933733 | 3.20E-06 | 1.26E-13 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719933733 | NA | 3.35E-12 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719933733 | NA | 1.90E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719933733 | 5.22E-11 | 3.34E-17 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719933733 | 1.39E-07 | 1.18E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0719933733 | NA | 4.69E-06 | mr1173_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719933733 | NA | 6.86E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719933733 | NA | 4.26E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719933733 | NA | 6.02E-06 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719933733 | NA | 6.29E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719933733 | NA | 4.82E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719933733 | 4.23E-06 | 9.56E-10 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719933733 | 2.30E-06 | NA | mr1807_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719933733 | 2.34E-07 | 2.33E-11 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |