\
| Variant ID: vg0719897669 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19897669 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCAGGCTTTTTTTTTGTCTTCTGTATAAGGTTTTCGCCGGTTTTACTTTAGCAAACCGTGCTATTGTATGGTTTTTGGGTCCGGTTTTCCTTATAAATAG[A/G]
TTCAACTCTATCTTTCTAATATATTCGGCAATACTCTTGCCACTTCCACATAAAAAAATGCAGGTCAGAACAGAGGGTAACAATCAAGACACACAGACCA
TGGTCTGTGTGTCTTGATTGTTACCCTCTGTTCTGACCTGCATTTTTTTATGTGGAAGTGGCAAGAGTATTGCCGAATATATTAGAAAGATAGAGTTGAA[T/C]
CTATTTATAAGGAAAACCGGACCCAAAAACCATACAATAGCACGGTTTGCTAAAGTAAAACCGGCGAAAACCTTATACAGAAGACAAAAAAAAAGCCTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 16.90% | 0.11% | 2.05% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.07% | NA |
| All Japonica | 1512 | 49.00% | 50.50% | 0.07% | 0.40% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.90% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 47.70% | 52.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 33.60% | 63.90% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 11.50% | 2.10% | 4.17% | 82.29% | NA |
| Intermediate | 90 | 71.10% | 17.80% | 0.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719897669 | A -> DEL | N | N | silent_mutation | Average:50.261; most accessible tissue: Zhenshan97 root, score: 64.045 | N | N | N | N |
| vg0719897669 | A -> G | LOC_Os07g33280.1 | upstream_gene_variant ; 1541.0bp to feature; MODIFIER | silent_mutation | Average:50.261; most accessible tissue: Zhenshan97 root, score: 64.045 | N | N | N | N |
| vg0719897669 | A -> G | LOC_Os07g33270-LOC_Os07g33280 | intergenic_region ; MODIFIER | silent_mutation | Average:50.261; most accessible tissue: Zhenshan97 root, score: 64.045 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719897669 | NA | 5.41E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 2.70E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 5.46E-07 | mr1173_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 2.38E-06 | mr1187_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 3.65E-07 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 6.03E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 6.54E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | 7.14E-07 | 1.41E-12 | mr1749_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | 1.13E-06 | 1.20E-13 | mr1761_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 7.48E-06 | mr1761_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | 5.04E-08 | 5.90E-14 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 4.27E-06 | mr1821_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719897669 | NA | 1.74E-06 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |