\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719820571:

Variant ID: vg0719820571 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19820571
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTCCGCAAGGAAACGAGATAAGTGAGTAAAGATTATTGTGCTGAGTTTTCAGAGGTTGTCCTAGGTAGAGCAACTTGCACGTGTGGTCTTTTTTGAAG[G/A]
AATTGTGAGTTGGATCTTGGTGGTCACTCAATTCTAGAAAACGACCTAGAAGTGTTGAGTTGAAGGCTGTGGACCTCTTCTGGGATCTTTGCATAAGTGA

Reverse complement sequence

TCACTTATGCAAAGATCCCAGAAGAGGTCCACAGCCTTCAACTCAACACTTCTAGGTCGTTTTCTAGAATTGAGTGACCACCAAGATCCAACTCACAATT[C/T]
CTTCAAAAAAGACCACACGTGCAAGTTGCTCTACCTAGGACAACCTCTGAAAACTCAGCACAATAATCTTTACTCACTTATCTCGTTTCCTTGCGGAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.30% 20.10% 0.76% 55.86% NA
All Indica  2759 3.30% 8.20% 1.16% 87.42% NA
All Japonica  1512 64.30% 24.90% 0.26% 10.52% NA
Aus  269 4.80% 84.00% 0.00% 11.15% NA
Indica I  595 4.50% 0.30% 1.18% 93.95% NA
Indica II  465 4.10% 3.40% 1.51% 90.97% NA
Indica III  913 1.00% 15.70% 0.66% 82.69% NA
Indica Intermediate  786 4.50% 8.10% 1.53% 85.88% NA
Temperate Japonica  767 96.20% 2.50% 0.00% 1.30% NA
Tropical Japonica  504 12.50% 58.10% 0.79% 28.57% NA
Japonica Intermediate  241 71.00% 27.00% 0.00% 2.07% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 24.40% 32.20% 0.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719820571 G -> DEL N N silent_mutation Average:9.25; most accessible tissue: Callus, score: 22.075 N N N N
vg0719820571 G -> A LOC_Os07g33190.1 downstream_gene_variant ; 1548.0bp to feature; MODIFIER silent_mutation Average:9.25; most accessible tissue: Callus, score: 22.075 N N N N
vg0719820571 G -> A LOC_Os07g33190-LOC_Os07g33200 intergenic_region ; MODIFIER silent_mutation Average:9.25; most accessible tissue: Callus, score: 22.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719820571 NA 2.41E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 8.02E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 2.09E-07 2.74E-09 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 4.51E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 9.33E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 2.71E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 9.73E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 2.07E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 7.85E-07 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 2.44E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 3.44E-06 NA mr1325 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 8.04E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 2.51E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 2.87E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 8.08E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 1.36E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 2.57E-08 6.89E-08 mr1719 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 4.09E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 2.21E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 2.71E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 1.04E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 3.79E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 1.13E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719820571 NA 1.05E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251