\
| Variant ID: vg0719816046 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19816046 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 222. )
CGATTCGGATTATGCCTGGTGTAAGGTTGATAGAAAAAGCACAACCGGGACTTGCCAATTTCTTGGGCGGTCCCTTGTTTCTTGGTCCTCCAAGAAGCAA[A/C]
ATTCCATTGCATTATCCACCGCCAAAGCCGAATATGTCGCCGCCGGTTCTTGTTGTGCCCAACTCCTTTGGATGAAACAAACTCTAAAAGACTTTGGCTA
TAGCCAAAGTCTTTTAGAGTTTGTTTCATCCAAAGGAGTTGGGCACAACAAGAACCGGCGGCGACATATTCGGCTTTGGCGGTGGATAATGCAATGGAAT[T/G]
TTGCTTCTTGGAGGACCAAGAAACAAGGGACCGCCCAAGAAATTGGCAAGTCCCGGTTGTGCTTTTTCTATCAACCTTACACCAGGCATAATCCGAATCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.90% | 20.00% | 5.97% | 42.15% | NA |
| All Indica | 2759 | 16.60% | 8.10% | 6.31% | 68.94% | NA |
| All Japonica | 1512 | 66.20% | 24.70% | 6.81% | 2.25% | NA |
| Aus | 269 | 5.90% | 84.00% | 0.37% | 9.67% | NA |
| Indica I | 595 | 14.50% | 0.30% | 4.37% | 80.84% | NA |
| Indica II | 465 | 9.50% | 3.70% | 5.59% | 81.29% | NA |
| Indica III | 913 | 18.70% | 15.60% | 8.43% | 57.28% | NA |
| Indica Intermediate | 786 | 20.10% | 8.00% | 5.73% | 66.16% | NA |
| Temperate Japonica | 767 | 96.30% | 2.50% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 17.90% | 57.50% | 19.84% | 4.76% | NA |
| Japonica Intermediate | 241 | 71.40% | 27.00% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 31.10% | 4.44% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719816046 | A -> DEL | LOC_Os07g33190.1 | N | frameshift_variant | Average:6.392; most accessible tissue: Callus, score: 16.503 | N | N | N | N |
| vg0719816046 | A -> C | LOC_Os07g33190.1 | missense_variant ; p.Asn318His; MODERATE | nonsynonymous_codon | Average:6.392; most accessible tissue: Callus, score: 16.503 | probably damaging |
2.554 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719816046 | NA | 9.73E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 2.07E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 2.97E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 2.71E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 2.87E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 4.09E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 2.21E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 2.71E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 1.21E-07 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 4.38E-10 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 3.93E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 8.59E-07 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 9.65E-07 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 1.13E-09 | mr1364_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 1.05E-07 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | NA | 5.08E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719816046 | 2.53E-06 | NA | mr1923_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |