Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719815142:

Variant ID: vg0719815142 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19815142
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGTGGTTGTAAGGAACAAAGCCCGGTTAGTTGCGCAAGGGTTCACCCAAGTCGAGGGTCTCAATTTTGGTGAAACCTTCGCACCCGTTGCTCGTCTTGA[G/C]
TCAATCCGAATGCTTTTAGCCTATGCCGCTCACCATGATTTCAGGTTATATCAAATGGATGTCAAGAGTGCCTTTCTCAATGGACCCATCTCGGAATTGG

Reverse complement sequence

CCAATTCCGAGATGGGTCCATTGAGAAAGGCACTCTTGACATCCATTTGATATAACCTGAAATCATGGTGAGCGGCATAGGCTAAAAGCATTCGGATTGA[C/G]
TCAAGACGAGCAACGGGTGCGAAGGTTTCACCAAAATTGAGACCCTCGACTTGGGTGAACCCTTGCGCAACTAACCGGGCTTTGTTCCTTACAACCACTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.20%	5.70%	0.55%	56.50%	NA
All Indica	2759	9.40%	1.50%	0.83%	88.33%	NA
All Japonica	1512	89.00%	0.10%	0.07%	10.85%	NA
Aus	269	5.20%	83.60%	0.00%	11.15%	NA
Indica I	595	3.20%	0.20%	1.51%	95.13%	NA
Indica II	465	7.10%	0.20%	0.00%	92.69%	NA
Indica III	913	15.60%	1.00%	0.66%	82.80%	NA
Indica Intermediate	786	8.10%	3.80%	1.02%	87.02%	NA
Temperate Japonica	767	98.60%	0.00%	0.00%	1.43%	NA
Tropical Japonica	504	70.60%	0.00%	0.00%	29.37%	NA
Japonica Intermediate	241	96.70%	0.80%	0.41%	2.07%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	52.20%	2.20%	2.22%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719815142	G -> DEL	N	N	silent_mutation	Average:7.991; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0719815142	G -> C	LOC_Os07g33190.1	intron_variant ; MODIFIER	silent_mutation	Average:7.991; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719815142	NA	3.39E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	6.62E-39	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	5.62E-49	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	9.65E-39	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	7.78E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	1.00E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	3.34E-06	6.61E-06	mr1263_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	2.28E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	1.75E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	1.98E-34	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	2.09E-50	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	8.07E-06	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	4.59E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	1.62E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142	NA	2.69E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251