\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719815142:

Variant ID: vg0719815142 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19815142
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTGGTTGTAAGGAACAAAGCCCGGTTAGTTGCGCAAGGGTTCACCCAAGTCGAGGGTCTCAATTTTGGTGAAACCTTCGCACCCGTTGCTCGTCTTGA[G/C]
TCAATCCGAATGCTTTTAGCCTATGCCGCTCACCATGATTTCAGGTTATATCAAATGGATGTCAAGAGTGCCTTTCTCAATGGACCCATCTCGGAATTGG

Reverse complement sequence

CCAATTCCGAGATGGGTCCATTGAGAAAGGCACTCTTGACATCCATTTGATATAACCTGAAATCATGGTGAGCGGCATAGGCTAAAAGCATTCGGATTGA[C/G]
TCAAGACGAGCAACGGGTGCGAAGGTTTCACCAAAATTGAGACCCTCGACTTGGGTGAACCCTTGCGCAACTAACCGGGCTTTGTTCCTTACAACCACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 5.70% 0.55% 56.50% NA
All Indica  2759 9.40% 1.50% 0.83% 88.33% NA
All Japonica  1512 89.00% 0.10% 0.07% 10.85% NA
Aus  269 5.20% 83.60% 0.00% 11.15% NA
Indica I  595 3.20% 0.20% 1.51% 95.13% NA
Indica II  465 7.10% 0.20% 0.00% 92.69% NA
Indica III  913 15.60% 1.00% 0.66% 82.80% NA
Indica Intermediate  786 8.10% 3.80% 1.02% 87.02% NA
Temperate Japonica  767 98.60% 0.00% 0.00% 1.43% NA
Tropical Japonica  504 70.60% 0.00% 0.00% 29.37% NA
Japonica Intermediate  241 96.70% 0.80% 0.41% 2.07% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 52.20% 2.20% 2.22% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719815142 G -> DEL N N silent_mutation Average:7.991; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0719815142 G -> C LOC_Os07g33190.1 intron_variant ; MODIFIER silent_mutation Average:7.991; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719815142 NA 3.39E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 6.62E-39 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 5.62E-49 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 9.65E-39 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 7.78E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 1.00E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 3.34E-06 6.61E-06 mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 2.28E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 1.75E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 1.98E-34 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 2.09E-50 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 8.07E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 4.59E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 1.62E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719815142 NA 2.69E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251