\
| Variant ID: vg0719799826 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 19799826 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 100. )
GAGGCCTCGCTCATCTAAGTTATCACCTAAGGTGGATGAGGGATTCTTACTTGGCTATGAATCAAATGCACATGCCTACCGTGTCTTCAACAAAACCTCT[A/G]
GTATTGTTGAAGTTACAAGGGATGTGACATTTGACGAATCTAATGGCTCCCAAGGAGAGCAAGTTGTTGTACATGTTGTAGATGATGCGGATCCTAGACA
TGTCTAGGATCCGCATCATCTACAACATGTACAACAACTTGCTCTCCTTGGGAGCCATTAGATTCGTCAAATGTCACATCCCTTGTAACTTCAACAATAC[T/C]
AGAGGTTTTGTTGAAGACACGGTAGGCATGTGCATTTGATTCATAGCCAAGTAAGAATCCCTCATCCACCTTAGGTGATAACTTAGATGAGCGAGGCCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.90% | 28.20% | 2.09% | 3.83% | NA |
| All Indica | 2759 | 86.90% | 8.70% | 3.33% | 1.12% | NA |
| All Japonica | 1512 | 41.70% | 48.50% | 0.33% | 9.52% | NA |
| Aus | 269 | 11.20% | 87.70% | 0.00% | 1.12% | NA |
| Indica I | 595 | 90.80% | 0.30% | 6.55% | 2.35% | NA |
| Indica II | 465 | 90.30% | 4.50% | 4.09% | 1.08% | NA |
| Indica III | 913 | 82.30% | 15.80% | 1.64% | 0.33% | NA |
| Indica Intermediate | 786 | 87.30% | 9.20% | 2.42% | 1.15% | NA |
| Temperate Japonica | 767 | 54.50% | 45.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 12.70% | 58.50% | 0.79% | 27.98% | NA |
| Japonica Intermediate | 241 | 61.40% | 37.30% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 33.30% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0719799826 | A -> DEL | LOC_Os07g33160.1 | N | frameshift_variant | Average:6.608; most accessible tissue: Callus, score: 18.471 | N | N | N | N |
| vg0719799826 | A -> G | LOC_Os07g33160.1 | missense_variant ; p.Ser144Gly; MODERATE | nonsynonymous_codon ; S144G | Average:6.608; most accessible tissue: Callus, score: 18.471 | benign |
-0.699 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0719799826 | NA | 6.57E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | 7.07E-06 | NA | mr1076_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | 1.80E-06 | NA | mr1083_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | 6.69E-06 | NA | mr1085_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | 5.66E-06 | NA | mr1301_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | NA | 9.26E-06 | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | NA | 2.89E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | NA | 3.95E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | NA | 1.70E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | NA | 4.88E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | NA | 2.72E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0719799826 | 2.48E-06 | 9.73E-06 | mr1888_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |