Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719730010:

Variant ID: vg0719730010 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19730010
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCCATGTCTCCATGGTTCTACACCAAGATCGACTGAGGCGAGTACGACAAATGTCGACAAGGCTCCGTCGCAGACTCTACGCCTTCTCGATCACTCGA[G/T]
AATGGTTGCTGGATCTCGACAAGGAATACGGAATGAAGAAATGGTGTACCCGCCGAGATAAAATTTCTTGACTTCGATCCAAATTCTCGATTACAGCAAG

Reverse complement sequence

CTTGCTGTAATCGAGAATTTGGATCGAAGTCAAGAAATTTTATCTCGGCGGGTACACCATTTCTTCATTCCGTATTCCTTGTCGAGATCCAGCAACCATT[C/A]
TCGAGTGATCGAGAAGGCGTAGAGTCTGCGACGGAGCCTTGTCGACATTTGTCGTACTCGCCTCAGTCGATCTTGGTGTAGAACCATGGAGACATGGAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.10%	12.50%	6.92%	56.43%	NA
All Indica	2759	5.30%	1.40%	11.09%	82.24%	NA
All Japonica	1512	63.60%	34.90%	0.00%	1.59%	NA
Aus	269	2.20%	0.00%	6.32%	91.45%	NA
Indica I	595	2.50%	0.00%	6.72%	90.76%	NA
Indica II	465	4.70%	3.40%	10.32%	81.51%	NA
Indica III	913	5.10%	1.40%	15.88%	77.55%	NA
Indica Intermediate	786	7.80%	1.30%	9.29%	81.68%	NA
Temperate Japonica	767	95.70%	2.50%	0.00%	1.83%	NA
Tropical Japonica	504	11.90%	88.10%	0.00%	0.00%	NA
Japonica Intermediate	241	69.30%	26.60%	0.00%	4.15%	NA
VI/Aromatic	96	6.20%	6.20%	1.04%	86.46%	NA
Intermediate	90	23.30%	23.30%	3.33%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719730010	G -> DEL	N	N	silent_mutation	Average:8.426; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0719730010	G -> T	LOC_Os07g33030.1	upstream_gene_variant ; 1835.0bp to feature; MODIFIER	silent_mutation	Average:8.426; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0719730010	G -> T	LOC_Os07g33020.1	downstream_gene_variant ; 1867.0bp to feature; MODIFIER	silent_mutation	Average:8.426; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0719730010	G -> T	LOC_Os07g33020-LOC_Os07g33030	intergenic_region ; MODIFIER	silent_mutation	Average:8.426; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719730010	4.86E-11	NA	mr1083	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	6.46E-08	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	2.41E-06	5.53E-31	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	3.31E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	9.73E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.25E-18	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	3.08E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	7.21E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.88E-18	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	2.23E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	8.75E-09	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	9.09E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.02E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	2.29E-08	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	7.91E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	5.30E-10	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	4.95E-32	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.49E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	3.98E-12	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	9.77E-06	7.28E-11	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	6.94E-09	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	2.32E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	5.37E-28	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.87E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	6.22E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	4.32E-10	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	2.38E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.11E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.26E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	3.76E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.13E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	2.04E-34	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	2.05E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	4.60E-18	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	7.50E-06	mr1715_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	5.57E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	1.43E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	2.60E-15	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719730010	NA	5.20E-13	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251