\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719727339:

Variant ID: vg0719727339 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19727339
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGAACCATCATTGTCAAATTTTCGATCCGGCGAGATCGATCAATCTTCATCAAGACGTAGCCACCATGGAGGACGGCAAATCGGTATTGCCGCCCGCG[C/T]
GACTTCGGCCCAGATCGAACACGGTGCCGATTCCCACCAACCAAAATCGCTCAACGCAGGCTGCACATGATTCATCCGAGAACAAGTGCCGCTGTGTCAC

Reverse complement sequence

GTGACACAGCGGCACTTGTTCTCGGATGAATCATGTGCAGCCTGCGTTGAGCGATTTTGGTTGGTGGGAATCGGCACCGTGTTCGATCTGGGCCGAAGTC[G/A]
CGCGGGCGGCAATACCGATTTGCCGTCCTCCATGGTGGCTACGTCTTGATGAAGATTGATCGATCTCGCCGGATCGAAAATTTGACAATGATGGTTCCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 30.20% 0.36% 1.42% NA
All Indica  2759 91.90% 7.60% 0.40% 0.07% NA
All Japonica  1512 22.90% 76.70% 0.07% 0.33% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 86.20% 12.90% 0.86% 0.00% NA
Indica III  913 92.40% 7.00% 0.44% 0.11% NA
Indica Intermediate  786 89.60% 10.10% 0.25% 0.13% NA
Temperate Japonica  767 43.40% 56.50% 0.00% 0.13% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 92.90% 0.41% 1.66% NA
VI/Aromatic  96 25.00% 11.50% 2.08% 61.46% NA
Intermediate  90 47.80% 50.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719727339 C -> DEL LOC_Os07g33020.1 N frameshift_variant Average:58.906; most accessible tissue: Zhenshan97 flower, score: 90.807 N N N N
vg0719727339 C -> T LOC_Os07g33020.1 stop_gained ; p.Arg12*; HIGH stop_gained Average:58.906; most accessible tissue: Zhenshan97 flower, score: 90.807 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0719727339 C T 0.11 0.08 0.04 0.03 0.08 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719727339 9.83E-08 NA Plant_height All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719727339 1.81E-06 NA Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719727339 3.56E-06 NA Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719727339 NA 1.25E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 1.10E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 8.77E-14 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 8.43E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 6.68E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 4.12E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 7.76E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 1.62E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 2.30E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 7.73E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 5.69E-10 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 1.52E-14 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727339 NA 8.19E-10 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251