Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719727299:

Variant ID: vg0719727299 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19727299
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGGAGATCTAATCCGACCGGAGTATGTCGTCCAATAAGATCGGAACCATCATTGTCAAATTTTCGATCCGGCGAGATCGATCAATCTTCATCAAGACGT[A/G]
GCCACCATGGAGGACGGCAAATCGGTATTGCCGCCCGCGCGACTTCGGCCCAGATCGAACACGGTGCCGATTCCCACCAACCAAAATCGCTCAACGCAGG

Reverse complement sequence

CCTGCGTTGAGCGATTTTGGTTGGTGGGAATCGGCACCGTGTTCGATCTGGGCCGAAGTCGCGCGGGCGGCAATACCGATTTGCCGTCCTCCATGGTGGC[T/C]
ACGTCTTGATGAAGATTGATCGATCTCGCCGGATCGAAAATTTGACAATGATGGTTCCGATCTTATTGGACGACATACTCCGGTCGGATTAGATCTCCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	14.70%	0.40%	1.76%	NA
All Indica	2759	97.60%	2.10%	0.22%	0.04%	NA
All Japonica	1512	56.70%	41.20%	0.46%	1.65%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	97.80%	1.70%	0.43%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.30%	0.51%	0.13%	NA
Temperate Japonica	767	43.70%	55.30%	0.39%	0.65%	NA
Tropical Japonica	504	88.10%	10.50%	0.20%	1.19%	NA
Japonica Intermediate	241	32.40%	60.60%	1.24%	5.81%	NA
VI/Aromatic	96	34.40%	2.10%	5.21%	58.33%	NA
Intermediate	90	82.20%	15.60%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719727299	A -> DEL	N	N	silent_mutation	Average:56.996; most accessible tissue: Zhenshan97 flower, score: 90.278	N	N	N	N
vg0719727299	A -> G	LOC_Os07g33010.1	upstream_gene_variant ; 3685.0bp to feature; MODIFIER	silent_mutation	Average:56.996; most accessible tissue: Zhenshan97 flower, score: 90.278	N	N	N	N
vg0719727299	A -> G	LOC_Os07g33020.1	upstream_gene_variant ; 7.0bp to feature; MODIFIER	silent_mutation	Average:56.996; most accessible tissue: Zhenshan97 flower, score: 90.278	N	N	N	N
vg0719727299	A -> G	LOC_Os07g33030.1	upstream_gene_variant ; 4546.0bp to feature; MODIFIER	silent_mutation	Average:56.996; most accessible tissue: Zhenshan97 flower, score: 90.278	N	N	N	N
vg0719727299	A -> G	LOC_Os07g33010-LOC_Os07g33020	intergenic_region ; MODIFIER	silent_mutation	Average:56.996; most accessible tissue: Zhenshan97 flower, score: 90.278	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0719727299	A	G	0.0	-0.02	0.0	0.06	0.06	0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719727299	3.20E-07	NA	Plant_height	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719727299	1.09E-09	NA	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719727299	1.04E-07	NA	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719727299	NA	3.94E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719727299	NA	3.63E-09	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251