RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0719711141:

Variant ID: vg0719711141 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19711141
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CCCGTAGACATCCAGCAAGTGGAGACGAGAGCTCTGGCGACAACCGCGGTGAAGAAGACGACCATTGCCGCCGTTCACGGCCGGACAGGAAGCTGCCAGG[T/C]
TGCTCCGTGTGAGTCGACCAACCTTCGCCTCTGCCTCCATGTAAACACCCCTCAATCACAGTCAGGCGGCATGCCTTGTTCCATCCTTGGACGGATGAGC

Reverse complement sequence

GCTCATCCGTCCAAGGATGGAACAAGGCATGCCGCCTGACTGTGATTGAGGGGTGTTTACATGGAGGCAGAGGCGAAGGTTGGTCGACTCACACGGAGCA[A/G]
CCTGGCAGCTTCCTGTCCGGCCGTGAACGGCGGCAATGGTCGTCTTCTTCACCGCGGTTGTCGCCAGAGCTCTCGTCTCCACTTGCTGGATGTCTACGGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.50%	15.40%	0.36%	64.79%	NA
All Indica	2759	1.80%	2.20%	0.43%	95.58%	NA
All Japonica	1512	55.20%	42.90%	0.20%	1.65%	NA
Aus	269	0.00%	0.70%	0.74%	98.51%	NA
Indica I	595	0.50%	1.20%	0.17%	98.15%	NA
Indica II	465	3.90%	2.20%	0.22%	93.76%	NA
Indica III	913	1.50%	1.80%	0.33%	96.39%	NA
Indica Intermediate	786	1.90%	3.40%	0.89%	93.77%	NA
Temperate Japonica	767	41.90%	55.90%	0.26%	1.96%	NA
Tropical Japonica	504	88.70%	11.30%	0.00%	0.00%	NA
Japonica Intermediate	241	27.80%	67.60%	0.41%	4.15%	NA
VI/Aromatic	96	8.30%	2.10%	0.00%	89.58%	NA
Intermediate	90	30.00%	15.60%	0.00%	54.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719711141	T -> DEL	N	N	silent_mutation	Average:9.221; most accessible tissue: Callus, score: 42.217	N	N	N	N
vg0719711141	T -> C	LOC_Os07g33000.1	upstream_gene_variant ; 2054.0bp to feature; MODIFIER	silent_mutation	Average:9.221; most accessible tissue: Callus, score: 42.217	N	N	N	N
vg0719711141	T -> C	LOC_Os07g32990.1	downstream_gene_variant ; 1178.0bp to feature; MODIFIER	silent_mutation	Average:9.221; most accessible tissue: Callus, score: 42.217	N	N	N	N
vg0719711141	T -> C	LOC_Os07g32990-LOC_Os07g33000	intergenic_region ; MODIFIER	silent_mutation	Average:9.221; most accessible tissue: Callus, score: 42.217	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719711141	1.93E-09	NA	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719711141	1.64E-08	NA	Spikelet_length	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719711141	NA	8.51E-06	mr1154_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719711141	NA	1.76E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0719711141:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact